Incidental Mutation 'R4926:Mterf4'
ID379002
Institutional Source Beutler Lab
Gene Symbol Mterf4
Ensembl Gene ENSMUSG00000026273
Gene Namemitochondrial transcription termination factor 4
Synonyms4933412H03Rik, Mterfd2, 1810059A23Rik
MMRRC Submission 042527-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4926 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93299211-93305915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93304925 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 68 (E68G)
Ref Sequence ENSEMBL: ENSMUSP00000108566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027492] [ENSMUST00000027493] [ENSMUST00000062202] [ENSMUST00000112942] [ENSMUST00000112944]
Predicted Effect probably benign
Transcript: ENSMUST00000027492
AA Change: E68G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027492
Gene: ENSMUSG00000026273
AA Change: E68G

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Mterf 142 172 1.28e2 SMART
Mterf 177 208 1.1e1 SMART
Mterf 213 244 3.89e0 SMART
Mterf 246 274 2.06e2 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027493
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062202
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112942
AA Change: E68G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000108564
Gene: ENSMUSG00000026273
AA Change: E68G

DomainStartEndE-ValueType
PDB:4FP9|H 50 235 7e-55 PDB
Blast:Mterf 142 167 1e-7 BLAST
Blast:Mterf 178 208 8e-13 BLAST
Blast:Mterf 213 235 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112944
AA Change: E68G

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108566
Gene: ENSMUSG00000026273
AA Change: E68G

DomainStartEndE-ValueType
PDB:4FP9|H 50 235 6e-54 PDB
Blast:Mterf 142 167 6e-8 BLAST
Blast:Mterf 178 208 2e-12 BLAST
Blast:Mterf 213 235 1e-7 BLAST
low complexity region 253 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189856
Meta Mutation Damage Score 0.3875 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (87/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with decreased embryo size, lack of heart, and absence of optic discs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,395,299 D136V probably damaging Het
Ankrd17 G A 5: 90,300,032 R217W probably damaging Het
Ankrd23 A T 1: 36,531,987 H102Q probably damaging Het
Arfip2 G T 7: 105,637,944 R138S probably damaging Het
Arhgap27 A T 11: 103,339,123 probably null Het
Atg2a T C 19: 6,257,533 L1499P probably damaging Het
Bnc2 A G 4: 84,276,179 S110P probably damaging Het
Ccdc171 T C 4: 83,558,592 probably benign Het
Ccdc7a A G 8: 128,980,054 probably benign Het
Chd5 T C 4: 152,383,311 S1689P probably benign Het
Corin A G 5: 72,372,182 C212R probably damaging Het
Cyp2c65 A G 19: 39,061,153 I42V probably benign Het
Cyp3a25 G A 5: 145,991,456 R260C probably damaging Het
Dock6 T C 9: 21,845,791 Y116C probably damaging Het
Eif3a A G 19: 60,763,218 probably benign Het
Epop T C 11: 97,628,317 D322G probably damaging Het
Eps8l3 T A 3: 107,890,688 probably benign Het
Exph5 T C 9: 53,376,625 S1669P possibly damaging Het
Faah A T 4: 115,999,626 probably benign Het
Fanca A G 8: 123,303,985 C453R probably benign Het
Fcgbp T A 7: 28,086,235 C366S probably damaging Het
Fmn2 A G 1: 174,502,415 T124A unknown Het
Foxi3 C T 6: 70,957,012 S161L probably damaging Het
Foxo3 A T 10: 42,197,024 V499E probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Gm839 A C 6: 89,212,599 noncoding transcript Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
Hnrnpm G T 17: 33,649,801 R551S probably damaging Het
Hspa1l A G 17: 34,978,223 T413A possibly damaging Het
Hspg2 T C 4: 137,542,530 Y2297H probably damaging Het
Ighv1-81 T A 12: 115,920,473 I53L probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrrc41 T C 4: 116,089,324 V412A possibly damaging Het
Map4k4 A T 1: 40,017,225 E1023D probably damaging Het
Mark3 T A 12: 111,618,324 L118* probably null Het
Mrgpra9 T A 7: 47,235,011 T303S possibly damaging Het
Nckap5 A C 1: 126,528,641 probably benign Het
Nox3 T A 17: 3,669,894 T339S probably damaging Het
Nrip2 A C 6: 128,408,374 H256P probably benign Het
Oas1d T C 5: 120,915,768 V97A probably benign Het
Obox2 T A 7: 15,397,177 probably null Het
Olfr979 T C 9: 40,001,023 probably null Het
Opa1 T C 16: 29,648,973 F989S possibly damaging Het
Padi1 T A 4: 140,824,847 I429F probably damaging Het
Paics A G 5: 76,961,204 D163G probably damaging Het
Pik3c2b G T 1: 133,099,626 E1288* probably null Het
Prdm16 A T 4: 154,341,552 V593D possibly damaging Het
Prpf39 A G 12: 65,044,056 I165M possibly damaging Het
Pth2r A G 1: 65,321,984 T26A probably benign Het
Ptpn21 T C 12: 98,715,195 probably null Het
Rab44 C T 17: 29,139,555 A239V probably benign Het
Rtcb T C 10: 85,955,736 N52S probably benign Het
Sapcd2 T A 2: 25,373,566 probably null Het
Scaf11 T C 15: 96,418,242 E1147G possibly damaging Het
Selenoo T C 15: 89,099,678 Y595H probably damaging Het
Slc2a5 G T 4: 150,120,742 E3* probably null Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sorbs2 A G 8: 45,796,217 K755R probably benign Het
Sorbs3 G T 14: 70,186,945 P513T probably damaging Het
Sowaha T A 11: 53,479,510 E133V possibly damaging Het
Srsf5 T C 12: 80,947,301 probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tcp11l1 T C 2: 104,681,785 I501V probably benign Het
Tert A G 13: 73,648,389 K1080E possibly damaging Het
Tescl T A 7: 24,333,898 M1L possibly damaging Het
Thop1 T A 10: 81,073,367 probably null Het
Tmtc4 T C 14: 122,973,206 H80R probably damaging Het
Toe1 C T 4: 116,804,532 S480N probably damaging Het
Trap1 C A 16: 4,045,488 V557F probably benign Het
Trim30d T C 7: 104,483,357 E91G probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttll8 C A 15: 88,914,165 G789V probably damaging Het
Ulk4 A G 9: 121,258,732 F298S probably benign Het
Wwc1 C T 11: 35,889,400 A243T probably benign Het
Zfp248 A C 6: 118,429,826 H267Q possibly damaging Het
Zfyve26 T A 12: 79,275,011 M945L probably benign Het
Zufsp T C 10: 33,949,438 D16G probably damaging Het
Other mutations in Mterf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mterf4 APN 1 93305090 missense possibly damaging 0.83
IGL01686:Mterf4 APN 1 93304721 nonsense probably null
IGL01770:Mterf4 APN 1 93304994 missense probably damaging 1.00
IGL01801:Mterf4 APN 1 93304920 missense probably benign 0.02
IGL01881:Mterf4 APN 1 93304641 missense probably damaging 1.00
IGL02393:Mterf4 APN 1 93302879 missense possibly damaging 0.81
IGL02413:Mterf4 APN 1 93302804 missense probably damaging 1.00
IGL02812:Mterf4 APN 1 93304733 missense probably damaging 1.00
R4083:Mterf4 UTSW 1 93304658 missense possibly damaging 0.85
R4726:Mterf4 UTSW 1 93301749 missense probably damaging 0.98
R6091:Mterf4 UTSW 1 93301569 missense probably damaging 1.00
R7065:Mterf4 UTSW 1 93304895 missense probably benign 0.01
R7780:Mterf4 UTSW 1 93304967 missense probably benign 0.01
R7922:Mterf4 UTSW 1 93301553 nonsense probably null
X0065:Mterf4 UTSW 1 93301698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATACAGGCTCTGGGTTCAAC -3'
(R):5'- CTGAGTGGCATCGTCTACTG -3'

Sequencing Primer
(F):5'- TTCAACCCCAAGAGTAGGAGTTCTG -3'
(R):5'- GGCATCGTCTACTGGCCCTC -3'
Posted On2016-04-15