Mutagenetix > Incidental Mutations

Incidental Mutation 'R4926:Pik3c2b'

379004

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

042527-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.367) question?

Stock #

R4926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 133099626 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1288 (E1288*)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

Predicted Effect

probably null
Transcript: ENSMUST00000077730
AA Change: E1288*

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: E1288*

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.3%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	T	9: 108,395,299	D136V	probably damaging	Het
Ankrd17	G	A	5: 90,300,032	R217W	probably damaging	Het
Ankrd23	A	T	1: 36,531,987	H102Q	probably damaging	Het
Arfip2	G	T	7: 105,637,944	R138S	probably damaging	Het
Arhgap27	A	T	11: 103,339,123		probably null	Het
Atg2a	T	C	19: 6,257,533	L1499P	probably damaging	Het
Bnc2	A	G	4: 84,276,179	S110P	probably damaging	Het
Ccdc171	T	C	4: 83,558,592		probably benign	Het
Ccdc7a	A	G	8: 128,980,054		probably benign	Het
Chd5	T	C	4: 152,383,311	S1689P	probably benign	Het
Corin	A	G	5: 72,372,182	C212R	probably damaging	Het
Cyp2c65	A	G	19: 39,061,153	I42V	probably benign	Het
Cyp3a25	G	A	5: 145,991,456	R260C	probably damaging	Het
Dock6	T	C	9: 21,845,791	Y116C	probably damaging	Het
Eif3a	A	G	19: 60,763,218		probably benign	Het
Epop	T	C	11: 97,628,317	D322G	probably damaging	Het
Eps8l3	T	A	3: 107,890,688		probably benign	Het
Exph5	T	C	9: 53,376,625	S1669P	possibly damaging	Het
Faah	A	T	4: 115,999,626		probably benign	Het
Fanca	A	G	8: 123,303,985	C453R	probably benign	Het
Fcgbp	T	A	7: 28,086,235	C366S	probably damaging	Het
Fmn2	A	G	1: 174,502,415	T124A	unknown	Het
Foxi3	C	T	6: 70,957,012	S161L	probably damaging	Het
Foxo3	A	T	10: 42,197,024	V499E	probably damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gbgt1	T	C	2: 28,503,170	V90A	probably damaging	Het
Gm839	A	C	6: 89,212,599		noncoding transcript	Het
Gtf3c2	T	C	5: 31,169,123	E348G	possibly damaging	Het
Hnrnpm	G	T	17: 33,649,801	R551S	probably damaging	Het
Hspa1l	A	G	17: 34,978,223	T413A	possibly damaging	Het
Hspg2	T	C	4: 137,542,530	Y2297H	probably damaging	Het
Ighv1-81	T	A	12: 115,920,473	I53L	probably benign	Het
Kcnj11	C	T	7: 46,099,120	V260I	probably benign	Het
Krt84	A	G	15: 101,530,254	V266A	probably benign	Het
Lgals3bp	T	C	11: 118,393,955	Y266C	probably damaging	Het
Lrrc41	T	C	4: 116,089,324	V412A	possibly damaging	Het
Map4k4	A	T	1: 40,017,225	E1023D	probably damaging	Het
Mark3	T	A	12: 111,618,324	L118*	probably null	Het
Mrgpra9	T	A	7: 47,235,011	T303S	possibly damaging	Het
Mterf4	T	C	1: 93,304,925	E68G	probably benign	Het
Nckap5	A	C	1: 126,528,641		probably benign	Het
Nox3	T	A	17: 3,669,894	T339S	probably damaging	Het
Nrip2	A	C	6: 128,408,374	H256P	probably benign	Het
Oas1d	T	C	5: 120,915,768	V97A	probably benign	Het
Obox2	T	A	7: 15,397,177		probably null	Het
Olfr979	T	C	9: 40,001,023		probably null	Het
Opa1	T	C	16: 29,648,973	F989S	possibly damaging	Het
Padi1	T	A	4: 140,824,847	I429F	probably damaging	Het
Paics	A	G	5: 76,961,204	D163G	probably damaging	Het
Prdm16	A	T	4: 154,341,552	V593D	possibly damaging	Het
Prpf39	A	G	12: 65,044,056	I165M	possibly damaging	Het
Pth2r	A	G	1: 65,321,984	T26A	probably benign	Het
Ptpn21	T	C	12: 98,715,195		probably null	Het
Rab44	C	T	17: 29,139,555	A239V	probably benign	Het
Rtcb	T	C	10: 85,955,736	N52S	probably benign	Het
Sapcd2	T	A	2: 25,373,566		probably null	Het
Scaf11	T	C	15: 96,418,242	E1147G	possibly damaging	Het
Selenoo	T	C	15: 89,099,678	Y595H	probably damaging	Het
Slc2a5	G	T	4: 150,120,742	E3*	probably null	Het
Snw1	A	G	12: 87,452,658	V391A	probably benign	Het
Sorbs2	A	G	8: 45,796,217	K755R	probably benign	Het
Sorbs3	G	T	14: 70,186,945	P513T	probably damaging	Het
Sowaha	T	A	11: 53,479,510	E133V	possibly damaging	Het
Srsf5	T	C	12: 80,947,301		probably benign	Het
St8sia5	T	A	18: 77,254,782	M396K	possibly damaging	Het
Tcp11l1	T	C	2: 104,681,785	I501V	probably benign	Het
Tert	A	G	13: 73,648,389	K1080E	possibly damaging	Het
Tescl	T	A	7: 24,333,898	M1L	possibly damaging	Het
Thop1	T	A	10: 81,073,367		probably null	Het
Tmtc4	T	C	14: 122,973,206	H80R	probably damaging	Het
Toe1	C	T	4: 116,804,532	S480N	probably damaging	Het
Trap1	C	A	16: 4,045,488	V557F	probably benign	Het
Trim30d	T	C	7: 104,483,357	E91G	probably benign	Het
Ttf1	C	T	2: 29,064,656	H11Y	possibly damaging	Het
Ttll8	C	A	15: 88,914,165	G789V	probably damaging	Het
Ulk4	A	G	9: 121,258,732	F298S	probably benign	Het
Wwc1	C	T	11: 35,889,400	A243T	probably benign	Het
Zfp248	A	C	6: 118,429,826	H267Q	possibly damaging	Het
Zfyve26	T	A	12: 79,275,011	M945L	probably benign	Het
Zufsp	T	C	10: 33,949,438	D16G	probably damaging	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- TCTTCCCTAAGGGCATCCAG -3'
(R):5'- CCTTAACGTTTGGGCTAAGC -3'

Sequencing Primer
(F):5'- GGGGCCTGACCTCTTACTTTAG -3'
(R):5'- GCTAAGCCTGTCCCACTG -3'

Posted On

2016-04-15