Incidental Mutation 'R4926:Fmn2'
ID 379005
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Name formin 2
Synonyms
MMRRC Submission 042527-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.816) question?
Stock # R4926 (G1)
Quality Score 200
Status Validated
Chromosome 1
Chromosomal Location 174329391-174650295 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 174329981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 124 (T124A)
Ref Sequence ENSEMBL: ENSMUSP00000030039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
AlphaFold Q9JL04
Predicted Effect unknown
Transcript: ENSMUST00000030039
AA Change: T124A
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354
AA Change: T124A

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,272,498 (GRCm39) D136V probably damaging Het
Ankrd17 G A 5: 90,447,891 (GRCm39) R217W probably damaging Het
Ankrd23 A T 1: 36,571,068 (GRCm39) H102Q probably damaging Het
Arfip2 G T 7: 105,287,151 (GRCm39) R138S probably damaging Het
Arhgap27 A T 11: 103,229,949 (GRCm39) probably null Het
Atg2a T C 19: 6,307,563 (GRCm39) L1499P probably damaging Het
Bnc2 A G 4: 84,194,416 (GRCm39) S110P probably damaging Het
Ccdc171 T C 4: 83,476,829 (GRCm39) probably benign Het
Ccdc7a A G 8: 129,706,535 (GRCm39) probably benign Het
Chd5 T C 4: 152,467,768 (GRCm39) S1689P probably benign Het
Corin A G 5: 72,529,525 (GRCm39) C212R probably damaging Het
Cyp2c65 A G 19: 39,049,597 (GRCm39) I42V probably benign Het
Cyp3a25 G A 5: 145,928,266 (GRCm39) R260C probably damaging Het
Dock6 T C 9: 21,757,087 (GRCm39) Y116C probably damaging Het
Eif3a A G 19: 60,751,656 (GRCm39) probably benign Het
Epop T C 11: 97,519,143 (GRCm39) D322G probably damaging Het
Eps8l3 T A 3: 107,798,004 (GRCm39) probably benign Het
Exph5 T C 9: 53,287,925 (GRCm39) S1669P possibly damaging Het
Faah A T 4: 115,856,823 (GRCm39) probably benign Het
Fanca A G 8: 124,030,724 (GRCm39) C453R probably benign Het
Fcgbp T A 7: 27,785,660 (GRCm39) C366S probably damaging Het
Foxi3 C T 6: 70,933,996 (GRCm39) S161L probably damaging Het
Foxo3 A T 10: 42,073,020 (GRCm39) V499E probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gbgt1 T C 2: 28,393,182 (GRCm39) V90A probably damaging Het
Gm839 A C 6: 89,189,581 (GRCm39) noncoding transcript Het
Gtf3c2 T C 5: 31,326,467 (GRCm39) E348G possibly damaging Het
Hnrnpm G T 17: 33,868,775 (GRCm39) R551S probably damaging Het
Hspa1l A G 17: 35,197,199 (GRCm39) T413A possibly damaging Het
Hspg2 T C 4: 137,269,841 (GRCm39) Y2297H probably damaging Het
Ighv1-81 T A 12: 115,884,093 (GRCm39) I53L probably benign Het
Kcnj11 C T 7: 45,748,544 (GRCm39) V260I probably benign Het
Krt84 A G 15: 101,438,689 (GRCm39) V266A probably benign Het
Lgals3bp T C 11: 118,284,781 (GRCm39) Y266C probably damaging Het
Lrrc41 T C 4: 115,946,521 (GRCm39) V412A possibly damaging Het
Map4k4 A T 1: 40,056,385 (GRCm39) E1023D probably damaging Het
Mark3 T A 12: 111,584,758 (GRCm39) L118* probably null Het
Mrgpra9 T A 7: 46,884,759 (GRCm39) T303S possibly damaging Het
Mterf4 T C 1: 93,232,647 (GRCm39) E68G probably benign Het
Nckap5 A C 1: 126,456,378 (GRCm39) probably benign Het
Nox3 T A 17: 3,720,169 (GRCm39) T339S probably damaging Het
Nrip2 A C 6: 128,385,337 (GRCm39) H256P probably benign Het
Oas1d T C 5: 121,053,831 (GRCm39) V97A probably benign Het
Obox2 T A 7: 15,131,102 (GRCm39) probably null Het
Opa1 T C 16: 29,467,791 (GRCm39) F989S possibly damaging Het
Or10g9 T C 9: 39,912,319 (GRCm39) probably null Het
Padi1 T A 4: 140,552,158 (GRCm39) I429F probably damaging Het
Paics A G 5: 77,109,051 (GRCm39) D163G probably damaging Het
Pik3c2b G T 1: 133,027,364 (GRCm39) E1288* probably null Het
Prdm16 A T 4: 154,426,009 (GRCm39) V593D possibly damaging Het
Prpf39 A G 12: 65,090,830 (GRCm39) I165M possibly damaging Het
Pth2r A G 1: 65,361,143 (GRCm39) T26A probably benign Het
Ptpn21 T C 12: 98,681,454 (GRCm39) probably null Het
Rab44 C T 17: 29,358,529 (GRCm39) A239V probably benign Het
Rtcb T C 10: 85,791,600 (GRCm39) N52S probably benign Het
Sapcd2 T A 2: 25,263,578 (GRCm39) probably null Het
Scaf11 T C 15: 96,316,123 (GRCm39) E1147G possibly damaging Het
Selenoo T C 15: 88,983,881 (GRCm39) Y595H probably damaging Het
Slc2a5 G T 4: 150,205,199 (GRCm39) E3* probably null Het
Snw1 A G 12: 87,499,428 (GRCm39) V391A probably benign Het
Sorbs2 A G 8: 46,249,254 (GRCm39) K755R probably benign Het
Sorbs3 G T 14: 70,424,394 (GRCm39) P513T probably damaging Het
Sowaha T A 11: 53,370,337 (GRCm39) E133V possibly damaging Het
Srsf5 T C 12: 80,994,075 (GRCm39) probably benign Het
St8sia5 T A 18: 77,342,478 (GRCm39) M396K possibly damaging Het
Tcp11l1 T C 2: 104,512,130 (GRCm39) I501V probably benign Het
Tert A G 13: 73,796,508 (GRCm39) K1080E possibly damaging Het
Tescl T A 7: 24,033,323 (GRCm39) M1L possibly damaging Het
Thop1 T A 10: 80,909,201 (GRCm39) probably null Het
Tmtc4 T C 14: 123,210,618 (GRCm39) H80R probably damaging Het
Toe1 C T 4: 116,661,729 (GRCm39) S480N probably damaging Het
Trap1 C A 16: 3,863,352 (GRCm39) V557F probably benign Het
Trim30d T C 7: 104,132,564 (GRCm39) E91G probably benign Het
Ttf1 C T 2: 28,954,668 (GRCm39) H11Y possibly damaging Het
Ttll8 C A 15: 88,798,368 (GRCm39) G789V probably damaging Het
Ulk4 A G 9: 121,087,798 (GRCm39) F298S probably benign Het
Wwc1 C T 11: 35,780,227 (GRCm39) A243T probably benign Het
Zfp248 A C 6: 118,406,787 (GRCm39) H267Q possibly damaging Het
Zfyve26 T A 12: 79,321,785 (GRCm39) M945L probably benign Het
Zup1 T C 10: 33,825,434 (GRCm39) D16G probably damaging Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174,330,885 (GRCm39) missense unknown
IGL01085:Fmn2 APN 1 174,523,220 (GRCm39) missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174,329,994 (GRCm39) missense unknown
IGL02095:Fmn2 APN 1 174,330,167 (GRCm39) missense unknown
IGL02330:Fmn2 APN 1 174,437,511 (GRCm39) missense probably benign 0.38
IGL02552:Fmn2 APN 1 174,523,286 (GRCm39) missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174,409,625 (GRCm39) missense unknown
PIT4498001:Fmn2 UTSW 1 174,440,170 (GRCm39) missense probably damaging 1.00
PIT4677001:Fmn2 UTSW 1 174,474,699 (GRCm39) missense probably damaging 1.00
R0025:Fmn2 UTSW 1 174,618,880 (GRCm39) missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0306:Fmn2 UTSW 1 174,437,050 (GRCm39) unclassified probably benign
R0325:Fmn2 UTSW 1 174,437,520 (GRCm39) critical splice donor site probably null
R0403:Fmn2 UTSW 1 174,521,844 (GRCm39) missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174,409,525 (GRCm39) missense unknown
R0898:Fmn2 UTSW 1 174,331,026 (GRCm39) missense unknown
R1202:Fmn2 UTSW 1 174,440,101 (GRCm39) nonsense probably null
R1719:Fmn2 UTSW 1 174,436,024 (GRCm39) unclassified probably benign
R1763:Fmn2 UTSW 1 174,329,832 (GRCm39) missense unknown
R1771:Fmn2 UTSW 1 174,436,342 (GRCm39) unclassified probably benign
R1777:Fmn2 UTSW 1 174,409,488 (GRCm39) missense unknown
R1831:Fmn2 UTSW 1 174,437,511 (GRCm39) missense probably benign 0.38
R2259:Fmn2 UTSW 1 174,330,498 (GRCm39) missense unknown
R2960:Fmn2 UTSW 1 174,437,385 (GRCm39) missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174,330,192 (GRCm39) missense unknown
R3840:Fmn2 UTSW 1 174,409,599 (GRCm39) frame shift probably null
R4207:Fmn2 UTSW 1 174,409,521 (GRCm39) missense unknown
R4679:Fmn2 UTSW 1 174,330,728 (GRCm39) missense unknown
R4779:Fmn2 UTSW 1 174,437,461 (GRCm39) missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174,409,527 (GRCm39) missense unknown
R5007:Fmn2 UTSW 1 174,571,866 (GRCm39) missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174,648,794 (GRCm39) missense probably benign 0.04
R5324:Fmn2 UTSW 1 174,436,446 (GRCm39) unclassified probably benign
R5353:Fmn2 UTSW 1 174,330,572 (GRCm39) missense unknown
R5420:Fmn2 UTSW 1 174,526,344 (GRCm39) nonsense probably null
R5607:Fmn2 UTSW 1 174,437,377 (GRCm39) missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174,409,603 (GRCm39) missense unknown
R5982:Fmn2 UTSW 1 174,330,019 (GRCm39) missense unknown
R6148:Fmn2 UTSW 1 174,494,229 (GRCm39) missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174,440,119 (GRCm39) missense possibly damaging 0.87
R6466:Fmn2 UTSW 1 174,437,149 (GRCm39) unclassified probably benign
R6647:Fmn2 UTSW 1 174,420,670 (GRCm39) missense unknown
R6835:Fmn2 UTSW 1 174,527,235 (GRCm39) missense probably damaging 1.00
R7231:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7340:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7378:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7457:Fmn2 UTSW 1 174,331,303 (GRCm39) splice site probably null
R7474:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7564:Fmn2 UTSW 1 174,437,140 (GRCm39) missense unknown
R7582:Fmn2 UTSW 1 174,526,356 (GRCm39) missense probably damaging 1.00
R7748:Fmn2 UTSW 1 174,494,215 (GRCm39) missense probably damaging 1.00
R7832:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8035:Fmn2 UTSW 1 174,547,437 (GRCm39) missense probably damaging 1.00
R8203:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8343:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8371:Fmn2 UTSW 1 174,437,173 (GRCm39) missense unknown
R8377:Fmn2 UTSW 1 174,436,011 (GRCm39) nonsense probably null
R8543:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8724:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8726:Fmn2 UTSW 1 174,437,404 (GRCm39) missense possibly damaging 0.86
R8891:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R9074:Fmn2 UTSW 1 174,436,198 (GRCm39) missense unknown
R9167:Fmn2 UTSW 1 174,331,056 (GRCm39) missense unknown
R9489:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9598:Fmn2 UTSW 1 174,436,308 (GRCm39) missense unknown
R9605:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9698:Fmn2 UTSW 1 174,364,739 (GRCm39) missense unknown
RF010:Fmn2 UTSW 1 174,409,581 (GRCm39) missense unknown
Z1176:Fmn2 UTSW 1 174,435,960 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCTCGGTGTTTTCCAAC -3'
(R):5'- ACGAATTGCCTGCTGGATG -3'

Sequencing Primer
(F):5'- GTTTTCCAACCTGCGGATCAGAAAG -3'
(R):5'- CTGGATGTCTGAGAGCAAATCCTC -3'
Posted On 2016-04-15