Incidental Mutation 'R4926:Dock6'
ID379039
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 042527-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R4926 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21845791 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 116 (Y116C)
Ref Sequence ENSEMBL: ENSMUSP00000149156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000217336]
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: Y116C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: Y116C

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213775
Predicted Effect probably damaging
Transcript: ENSMUST00000217336
AA Change: Y116C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217515
Meta Mutation Damage Score 0.9095 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,395,299 D136V probably damaging Het
Ankrd17 G A 5: 90,300,032 R217W probably damaging Het
Ankrd23 A T 1: 36,531,987 H102Q probably damaging Het
Arfip2 G T 7: 105,637,944 R138S probably damaging Het
Arhgap27 A T 11: 103,339,123 probably null Het
Atg2a T C 19: 6,257,533 L1499P probably damaging Het
Bnc2 A G 4: 84,276,179 S110P probably damaging Het
Ccdc171 T C 4: 83,558,592 probably benign Het
Ccdc7a A G 8: 128,980,054 probably benign Het
Chd5 T C 4: 152,383,311 S1689P probably benign Het
Corin A G 5: 72,372,182 C212R probably damaging Het
Cyp2c65 A G 19: 39,061,153 I42V probably benign Het
Cyp3a25 G A 5: 145,991,456 R260C probably damaging Het
Eif3a A G 19: 60,763,218 probably benign Het
Epop T C 11: 97,628,317 D322G probably damaging Het
Eps8l3 T A 3: 107,890,688 probably benign Het
Exph5 T C 9: 53,376,625 S1669P possibly damaging Het
Faah A T 4: 115,999,626 probably benign Het
Fanca A G 8: 123,303,985 C453R probably benign Het
Fcgbp T A 7: 28,086,235 C366S probably damaging Het
Fmn2 A G 1: 174,502,415 T124A unknown Het
Foxi3 C T 6: 70,957,012 S161L probably damaging Het
Foxo3 A T 10: 42,197,024 V499E probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Gm839 A C 6: 89,212,599 noncoding transcript Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
Hnrnpm G T 17: 33,649,801 R551S probably damaging Het
Hspa1l A G 17: 34,978,223 T413A possibly damaging Het
Hspg2 T C 4: 137,542,530 Y2297H probably damaging Het
Ighv1-81 T A 12: 115,920,473 I53L probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrrc41 T C 4: 116,089,324 V412A possibly damaging Het
Map4k4 A T 1: 40,017,225 E1023D probably damaging Het
Mark3 T A 12: 111,618,324 L118* probably null Het
Mrgpra9 T A 7: 47,235,011 T303S possibly damaging Het
Mterf4 T C 1: 93,304,925 E68G probably benign Het
Nckap5 A C 1: 126,528,641 probably benign Het
Nox3 T A 17: 3,669,894 T339S probably damaging Het
Nrip2 A C 6: 128,408,374 H256P probably benign Het
Oas1d T C 5: 120,915,768 V97A probably benign Het
Obox2 T A 7: 15,397,177 probably null Het
Olfr979 T C 9: 40,001,023 probably null Het
Opa1 T C 16: 29,648,973 F989S possibly damaging Het
Padi1 T A 4: 140,824,847 I429F probably damaging Het
Paics A G 5: 76,961,204 D163G probably damaging Het
Pik3c2b G T 1: 133,099,626 E1288* probably null Het
Prdm16 A T 4: 154,341,552 V593D possibly damaging Het
Prpf39 A G 12: 65,044,056 I165M possibly damaging Het
Pth2r A G 1: 65,321,984 T26A probably benign Het
Ptpn21 T C 12: 98,715,195 probably null Het
Rab44 C T 17: 29,139,555 A239V probably benign Het
Rtcb T C 10: 85,955,736 N52S probably benign Het
Sapcd2 T A 2: 25,373,566 probably null Het
Scaf11 T C 15: 96,418,242 E1147G possibly damaging Het
Selenoo T C 15: 89,099,678 Y595H probably damaging Het
Slc2a5 G T 4: 150,120,742 E3* probably null Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sorbs2 A G 8: 45,796,217 K755R probably benign Het
Sorbs3 G T 14: 70,186,945 P513T probably damaging Het
Sowaha T A 11: 53,479,510 E133V possibly damaging Het
Srsf5 T C 12: 80,947,301 probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tcp11l1 T C 2: 104,681,785 I501V probably benign Het
Tert A G 13: 73,648,389 K1080E possibly damaging Het
Tescl T A 7: 24,333,898 M1L possibly damaging Het
Thop1 T A 10: 81,073,367 probably null Het
Tmtc4 T C 14: 122,973,206 H80R probably damaging Het
Toe1 C T 4: 116,804,532 S480N probably damaging Het
Trap1 C A 16: 4,045,488 V557F probably benign Het
Trim30d T C 7: 104,483,357 E91G probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttll8 C A 15: 88,914,165 G789V probably damaging Het
Ulk4 A G 9: 121,258,732 F298S probably benign Het
Wwc1 C T 11: 35,889,400 A243T probably benign Het
Zfp248 A C 6: 118,429,826 H267Q possibly damaging Het
Zfyve26 T A 12: 79,275,011 M945L probably benign Het
Zufsp T C 10: 33,949,438 D16G probably damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7930:Dock6 UTSW 9 21801207 missense unknown
R7946:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
R8184:Dock6 UTSW 9 21830300 missense not run
R8213:Dock6 UTSW 9 21831444 missense not run
Predicted Primers PCR Primer
(F):5'- TGGTGAGCCAACAGTGACAC -3'
(R):5'- AACTGTGAAGGTTCATGCATTC -3'

Sequencing Primer
(F):5'- CAGTGACACCTACCTTTAACTAATG -3'
(R):5'- TGAGGCAGAGTCTCTCACTTGAAC -3'
Posted On2016-04-15