Incidental Mutation 'R4926:Foxo3'
ID379045
Institutional Source Beutler Lab
Gene Symbol Foxo3
Ensembl Gene ENSMUSG00000048756
Gene Nameforkhead box O3
SynonymsFKHRL1, 2010203A17Rik, 1110048B16Rik, Foxo3a, Fkhr2
MMRRC Submission 042527-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4926 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location42181841-42276755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42197024 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 499 (V499E)
Ref Sequence ENSEMBL: ENSMUSP00000135380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056974] [ENSMUST00000105502] [ENSMUST00000175881] [ENSMUST00000177542]
Predicted Effect probably damaging
Transcript: ENSMUST00000056974
AA Change: V499E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050683
Gene: ENSMUSG00000048756
AA Change: V499E

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 107 146 N/A INTRINSIC
FH 154 244 1.3e-45 SMART
low complexity region 266 276 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Pfam:FOXO_KIX_bdg 431 510 5.5e-36 PFAM
low complexity region 529 538 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
Pfam:FOXO-TAD 603 644 1.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105502
AA Change: V499E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101141
Gene: ENSMUSG00000048756
AA Change: V499E

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 107 146 N/A INTRINSIC
FH 154 244 1.3e-45 SMART
low complexity region 266 276 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 529 538 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175881
AA Change: V499E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135380
Gene: ENSMUSG00000048756
AA Change: V499E

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 107 146 N/A INTRINSIC
FH 154 244 1.3e-45 SMART
low complexity region 266 276 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 529 538 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177542
SMART Domains Protein: ENSMUSP00000135355
Gene: ENSMUSG00000048756

DomainStartEndE-ValueType
SCOP:d1e17a_ 1 21 3e-4 SMART
Blast:FH 1 28 4e-10 BLAST
PDB:3COA|F 1 43 1e-18 PDB
low complexity region 47 57 N/A INTRINSIC
Meta Mutation Damage Score 0.5073 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. This gene likely functions as a trigger for apoptosis through expression of genes necessary for cell death. Translocation of this gene with the MLL gene is associated with secondary acute leukemia. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of the locus results in an ovarian defect involving follicular growth activation and leads progressively to female sterility. For some alleles defects in immune system function and hematopoiesis have also been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,395,299 D136V probably damaging Het
Ankrd17 G A 5: 90,300,032 R217W probably damaging Het
Ankrd23 A T 1: 36,531,987 H102Q probably damaging Het
Arfip2 G T 7: 105,637,944 R138S probably damaging Het
Arhgap27 A T 11: 103,339,123 probably null Het
Atg2a T C 19: 6,257,533 L1499P probably damaging Het
Bnc2 A G 4: 84,276,179 S110P probably damaging Het
Ccdc171 T C 4: 83,558,592 probably benign Het
Ccdc7a A G 8: 128,980,054 probably benign Het
Chd5 T C 4: 152,383,311 S1689P probably benign Het
Corin A G 5: 72,372,182 C212R probably damaging Het
Cyp2c65 A G 19: 39,061,153 I42V probably benign Het
Cyp3a25 G A 5: 145,991,456 R260C probably damaging Het
Dock6 T C 9: 21,845,791 Y116C probably damaging Het
Eif3a A G 19: 60,763,218 probably benign Het
Epop T C 11: 97,628,317 D322G probably damaging Het
Eps8l3 T A 3: 107,890,688 probably benign Het
Exph5 T C 9: 53,376,625 S1669P possibly damaging Het
Faah A T 4: 115,999,626 probably benign Het
Fanca A G 8: 123,303,985 C453R probably benign Het
Fcgbp T A 7: 28,086,235 C366S probably damaging Het
Fmn2 A G 1: 174,502,415 T124A unknown Het
Foxi3 C T 6: 70,957,012 S161L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Gm839 A C 6: 89,212,599 noncoding transcript Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
Hnrnpm G T 17: 33,649,801 R551S probably damaging Het
Hspa1l A G 17: 34,978,223 T413A possibly damaging Het
Hspg2 T C 4: 137,542,530 Y2297H probably damaging Het
Ighv1-81 T A 12: 115,920,473 I53L probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrrc41 T C 4: 116,089,324 V412A possibly damaging Het
Map4k4 A T 1: 40,017,225 E1023D probably damaging Het
Mark3 T A 12: 111,618,324 L118* probably null Het
Mrgpra9 T A 7: 47,235,011 T303S possibly damaging Het
Mterf4 T C 1: 93,304,925 E68G probably benign Het
Nckap5 A C 1: 126,528,641 probably benign Het
Nox3 T A 17: 3,669,894 T339S probably damaging Het
Nrip2 A C 6: 128,408,374 H256P probably benign Het
Oas1d T C 5: 120,915,768 V97A probably benign Het
Obox2 T A 7: 15,397,177 probably null Het
Olfr979 T C 9: 40,001,023 probably null Het
Opa1 T C 16: 29,648,973 F989S possibly damaging Het
Padi1 T A 4: 140,824,847 I429F probably damaging Het
Paics A G 5: 76,961,204 D163G probably damaging Het
Pik3c2b G T 1: 133,099,626 E1288* probably null Het
Prdm16 A T 4: 154,341,552 V593D possibly damaging Het
Prpf39 A G 12: 65,044,056 I165M possibly damaging Het
Pth2r A G 1: 65,321,984 T26A probably benign Het
Ptpn21 T C 12: 98,715,195 probably null Het
Rab44 C T 17: 29,139,555 A239V probably benign Het
Rtcb T C 10: 85,955,736 N52S probably benign Het
Sapcd2 T A 2: 25,373,566 probably null Het
Scaf11 T C 15: 96,418,242 E1147G possibly damaging Het
Selenoo T C 15: 89,099,678 Y595H probably damaging Het
Slc2a5 G T 4: 150,120,742 E3* probably null Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sorbs2 A G 8: 45,796,217 K755R probably benign Het
Sorbs3 G T 14: 70,186,945 P513T probably damaging Het
Sowaha T A 11: 53,479,510 E133V possibly damaging Het
Srsf5 T C 12: 80,947,301 probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tcp11l1 T C 2: 104,681,785 I501V probably benign Het
Tert A G 13: 73,648,389 K1080E possibly damaging Het
Tescl T A 7: 24,333,898 M1L possibly damaging Het
Thop1 T A 10: 81,073,367 probably null Het
Tmtc4 T C 14: 122,973,206 H80R probably damaging Het
Toe1 C T 4: 116,804,532 S480N probably damaging Het
Trap1 C A 16: 4,045,488 V557F probably benign Het
Trim30d T C 7: 104,483,357 E91G probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttll8 C A 15: 88,914,165 G789V probably damaging Het
Ulk4 A G 9: 121,258,732 F298S probably benign Het
Wwc1 C T 11: 35,889,400 A243T probably benign Het
Zfp248 A C 6: 118,429,826 H267Q possibly damaging Het
Zfyve26 T A 12: 79,275,011 M945L probably benign Het
Zufsp T C 10: 33,949,438 D16G probably damaging Het
Other mutations in Foxo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0486:Foxo3 UTSW 10 42197481 missense probably damaging 1.00
R1558:Foxo3 UTSW 10 42197072 missense probably damaging 0.99
R1819:Foxo3 UTSW 10 42197611 missense probably benign 0.12
R1970:Foxo3 UTSW 10 42197262 missense probably benign 0.24
R1971:Foxo3 UTSW 10 42197262 missense probably benign 0.24
R2447:Foxo3 UTSW 10 42197820 missense probably benign
R3016:Foxo3 UTSW 10 42197356 missense probably benign 0.00
R4719:Foxo3 UTSW 10 42197778 missense probably damaging 1.00
R5908:Foxo3 UTSW 10 42196587 missense probably benign 0.03
R6053:Foxo3 UTSW 10 42197214 missense probably benign 0.26
R7142:Foxo3 UTSW 10 42274595 intron probably null
R7328:Foxo3 UTSW 10 42197262 missense probably benign 0.14
R7386:Foxo3 UTSW 10 42197360 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGAGTCACTCAAGCCCATG -3'
(R):5'- TTCAACAGTACCGTGTTTGGACC -3'

Sequencing Primer
(F):5'- TCAAGCCCATGTTGCTGACAG -3'
(R):5'- AGTACCGTGTTTGGACCTTCGTC -3'
Posted On2016-04-15