Incidental Mutation 'R4926:Hnrnpm'
ID379070
Institutional Source Beutler Lab
Gene Symbol Hnrnpm
Ensembl Gene ENSMUSG00000059208
Gene Nameheterogeneous nuclear ribonucleoprotein M
SynonymsHnrpm, 2610023M21Rik
MMRRC Submission 042527-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4926 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33646233-33686860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33649801 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 551 (R551S)
Ref Sequence ENSEMBL: ENSMUSP00000115787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052079] [ENSMUST00000087582] [ENSMUST00000114385] [ENSMUST00000116619] [ENSMUST00000139302] [ENSMUST00000148178]
Predicted Effect probably benign
Transcript: ENSMUST00000052079
SMART Domains Protein: ENSMUSP00000057065
Gene: ENSMUSG00000032739

DomainStartEndE-ValueType
internal_repeat_1 15 151 3.3e-6 PROSPERO
internal_repeat_1 237 378 3.3e-6 PROSPERO
low complexity region 393 404 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 480 486 N/A INTRINSIC
SH3 581 655 1.09e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000087582
AA Change: R551S

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084864
Gene: ENSMUSG00000059208
AA Change: R551S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.7e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 2e-50 BLAST
low complexity region 590 603 N/A INTRINSIC
RRM 614 685 1.51e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114385
AA Change: R590S

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110027
Gene: ENSMUSG00000059208
AA Change: R590S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.5e-20 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 3.9e-5 PROSPERO
internal_repeat_2 479 581 3.9e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
internal_repeat_1 643 676 1.39e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000116619
Predicted Effect probably benign
Transcript: ENSMUST00000130946
SMART Domains Protein: ENSMUSP00000116671
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139302
AA Change: R551S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115787
Gene: ENSMUSG00000059208
AA Change: R551S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.4e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 8e-51 BLAST
low complexity region 590 603 N/A INTRINSIC
internal_repeat_1 611 635 5.49e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000148178
AA Change: R590S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120115
Gene: ENSMUSG00000059208
AA Change: R590S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.2e-22 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 6.64e-5 PROSPERO
internal_repeat_2 479 581 6.64e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
RRM 653 724 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148258
SMART Domains Protein: ENSMUSP00000123580
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
RRM 21 93 1.66e-20 SMART
low complexity region 113 130 N/A INTRINSIC
low complexity region 146 167 N/A INTRINSIC
low complexity region 196 202 N/A INTRINSIC
internal_repeat_1 206 227 9.85e-5 PROSPERO
internal_repeat_1 221 238 9.85e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166215
Meta Mutation Damage Score 0.1617 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs. This protein also constitutes a monomer of the N-acetylglucosamine-specific receptor which is postulated to trigger selective recycling of immature GlcNAc-bearing thyroglobulin molecules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,395,299 D136V probably damaging Het
Ankrd17 G A 5: 90,300,032 R217W probably damaging Het
Ankrd23 A T 1: 36,531,987 H102Q probably damaging Het
Arfip2 G T 7: 105,637,944 R138S probably damaging Het
Arhgap27 A T 11: 103,339,123 probably null Het
Atg2a T C 19: 6,257,533 L1499P probably damaging Het
Bnc2 A G 4: 84,276,179 S110P probably damaging Het
Ccdc171 T C 4: 83,558,592 probably benign Het
Ccdc7a A G 8: 128,980,054 probably benign Het
Chd5 T C 4: 152,383,311 S1689P probably benign Het
Corin A G 5: 72,372,182 C212R probably damaging Het
Cyp2c65 A G 19: 39,061,153 I42V probably benign Het
Cyp3a25 G A 5: 145,991,456 R260C probably damaging Het
Dock6 T C 9: 21,845,791 Y116C probably damaging Het
Eif3a A G 19: 60,763,218 probably benign Het
Epop T C 11: 97,628,317 D322G probably damaging Het
Eps8l3 T A 3: 107,890,688 probably benign Het
Exph5 T C 9: 53,376,625 S1669P possibly damaging Het
Faah A T 4: 115,999,626 probably benign Het
Fanca A G 8: 123,303,985 C453R probably benign Het
Fcgbp T A 7: 28,086,235 C366S probably damaging Het
Fmn2 A G 1: 174,502,415 T124A unknown Het
Foxi3 C T 6: 70,957,012 S161L probably damaging Het
Foxo3 A T 10: 42,197,024 V499E probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Gm839 A C 6: 89,212,599 noncoding transcript Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
Hspa1l A G 17: 34,978,223 T413A possibly damaging Het
Hspg2 T C 4: 137,542,530 Y2297H probably damaging Het
Ighv1-81 T A 12: 115,920,473 I53L probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrrc41 T C 4: 116,089,324 V412A possibly damaging Het
Map4k4 A T 1: 40,017,225 E1023D probably damaging Het
Mark3 T A 12: 111,618,324 L118* probably null Het
Mrgpra9 T A 7: 47,235,011 T303S possibly damaging Het
Mterf4 T C 1: 93,304,925 E68G probably benign Het
Nckap5 A C 1: 126,528,641 probably benign Het
Nox3 T A 17: 3,669,894 T339S probably damaging Het
Nrip2 A C 6: 128,408,374 H256P probably benign Het
Oas1d T C 5: 120,915,768 V97A probably benign Het
Obox2 T A 7: 15,397,177 probably null Het
Olfr979 T C 9: 40,001,023 probably null Het
Opa1 T C 16: 29,648,973 F989S possibly damaging Het
Padi1 T A 4: 140,824,847 I429F probably damaging Het
Paics A G 5: 76,961,204 D163G probably damaging Het
Pik3c2b G T 1: 133,099,626 E1288* probably null Het
Prdm16 A T 4: 154,341,552 V593D possibly damaging Het
Prpf39 A G 12: 65,044,056 I165M possibly damaging Het
Pth2r A G 1: 65,321,984 T26A probably benign Het
Ptpn21 T C 12: 98,715,195 probably null Het
Rab44 C T 17: 29,139,555 A239V probably benign Het
Rtcb T C 10: 85,955,736 N52S probably benign Het
Sapcd2 T A 2: 25,373,566 probably null Het
Scaf11 T C 15: 96,418,242 E1147G possibly damaging Het
Selenoo T C 15: 89,099,678 Y595H probably damaging Het
Slc2a5 G T 4: 150,120,742 E3* probably null Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sorbs2 A G 8: 45,796,217 K755R probably benign Het
Sorbs3 G T 14: 70,186,945 P513T probably damaging Het
Sowaha T A 11: 53,479,510 E133V possibly damaging Het
Srsf5 T C 12: 80,947,301 probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tcp11l1 T C 2: 104,681,785 I501V probably benign Het
Tert A G 13: 73,648,389 K1080E possibly damaging Het
Tescl T A 7: 24,333,898 M1L possibly damaging Het
Thop1 T A 10: 81,073,367 probably null Het
Tmtc4 T C 14: 122,973,206 H80R probably damaging Het
Toe1 C T 4: 116,804,532 S480N probably damaging Het
Trap1 C A 16: 4,045,488 V557F probably benign Het
Trim30d T C 7: 104,483,357 E91G probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttll8 C A 15: 88,914,165 G789V probably damaging Het
Ulk4 A G 9: 121,258,732 F298S probably benign Het
Wwc1 C T 11: 35,889,400 A243T probably benign Het
Zfp248 A C 6: 118,429,826 H267Q possibly damaging Het
Zfyve26 T A 12: 79,275,011 M945L probably benign Het
Zufsp T C 10: 33,949,438 D16G probably damaging Het
Other mutations in Hnrnpm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00869:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00870:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00886:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00898:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00900:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00901:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00905:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00907:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00908:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00911:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00912:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00920:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00921:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00922:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00923:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00924:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00926:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00927:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00928:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00929:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00930:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00931:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00932:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00935:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00938:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00945:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00950:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00952:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00953:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00954:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00955:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00956:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00957:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00958:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00959:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00960:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL01301:Hnrnpm APN 17 33669168 critical splice donor site probably null
IGL02152:Hnrnpm APN 17 33658412 missense probably damaging 1.00
IGL02319:Hnrnpm APN 17 33649950 missense probably damaging 0.98
IGL02487:Hnrnpm APN 17 33648813 missense probably damaging 1.00
IGL03099:Hnrnpm APN 17 33669172 missense probably damaging 1.00
ANU18:Hnrnpm UTSW 17 33669168 critical splice donor site probably null
E0370:Hnrnpm UTSW 17 33658922 splice site probably benign
R0153:Hnrnpm UTSW 17 33646515 missense probably damaging 0.99
R0254:Hnrnpm UTSW 17 33652268 splice site probably null
R0606:Hnrnpm UTSW 17 33658390 missense probably damaging 0.97
R0940:Hnrnpm UTSW 17 33650002 missense probably damaging 1.00
R1216:Hnrnpm UTSW 17 33649713 missense probably damaging 0.99
R1392:Hnrnpm UTSW 17 33658415 missense possibly damaging 0.62
R1392:Hnrnpm UTSW 17 33658415 missense possibly damaging 0.62
R1454:Hnrnpm UTSW 17 33666488 splice site probably benign
R2011:Hnrnpm UTSW 17 33664624 missense probably damaging 1.00
R4678:Hnrnpm UTSW 17 33650211 missense possibly damaging 0.54
R7456:Hnrnpm UTSW 17 33646648 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTTCTCACAAATATCTGGCAGGC -3'
(R):5'- GCCTAAGCATGGATCGGATG -3'

Sequencing Primer
(F):5'- AAATATCTGGCAGGCCTTCC -3'
(R):5'- TAAGCATGGATCGGATGGTGCC -3'
Posted On2016-04-15