Mutagenetix > Incidental Mutations

Incidental Mutation 'R4926:Hnrnpm'

379070

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpm

Ensembl Gene

ENSMUSG00000059208

Gene Name

heterogeneous nuclear ribonucleoprotein M

Synonyms

Hnrpm, 2610023M21Rik

MMRRC Submission

042527-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33646233-33686860 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 33649801 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 551 (R551S)

Ref Sequence

ENSEMBL: ENSMUSP00000115787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052079] [ENSMUST00000087582] [ENSMUST00000114385] [ENSMUST00000116619] [ENSMUST00000139302] [ENSMUST00000148178]

Predicted Effect

probably benign
Transcript: ENSMUST00000052079

SMART Domains

Protein: ENSMUSP00000057065
Gene: ENSMUSG00000032739

Domain	Start	End	E-Value	Type
internal_repeat_1	15	151	3.3e-6	PROSPERO
internal_repeat_1	237	378	3.3e-6	PROSPERO
low complexity region	393	404	N/A	INTRINSIC
low complexity region	445	453	N/A	INTRINSIC
low complexity region	458	471	N/A	INTRINSIC
low complexity region	480	486	N/A	INTRINSIC
SH3	581	655	1.09e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087582
AA Change: R551S

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000084864
Gene: ENSMUSG00000059208
AA Change: R551S

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:HnRNP_M	40	69	2.7e-20	PFAM
RRM	71	144	2.35e-20	SMART
RRM	165	237	1.66e-20	SMART
low complexity region	257	274	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC
low complexity region	350	356	N/A	INTRINSIC
Blast:AAA	430	589	2e-50	BLAST
low complexity region	590	603	N/A	INTRINSIC
RRM	614	685	1.51e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114385
AA Change: R590S

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110027
Gene: ENSMUSG00000059208
AA Change: R590S

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:HnRNP_M	40	69	1.5e-20	PFAM
RRM	71	144	2.35e-20	SMART
low complexity region	164	175	N/A	INTRINSIC
low complexity region	176	193	N/A	INTRINSIC
RRM	204	276	1.66e-20	SMART
low complexity region	296	313	N/A	INTRINSIC
internal_repeat_2	332	432	3.9e-5	PROSPERO
internal_repeat_2	479	581	3.9e-5	PROSPERO
low complexity region	591	602	N/A	INTRINSIC
low complexity region	606	616	N/A	INTRINSIC
low complexity region	629	642	N/A	INTRINSIC
internal_repeat_1	643	676	1.39e-5	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000116619

Predicted Effect

probably benign
Transcript: ENSMUST00000130946

SMART Domains

Protein: ENSMUSP00000116671
Gene: ENSMUSG00000059208

Domain	Start	End	E-Value	Type
low complexity region	28	42	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000139302
AA Change: R551S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115787
Gene: ENSMUSG00000059208
AA Change: R551S

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:HnRNP_M	40	69	1.4e-20	PFAM
RRM	71	144	2.35e-20	SMART
RRM	165	237	1.66e-20	SMART
low complexity region	257	274	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC
low complexity region	350	356	N/A	INTRINSIC
Blast:AAA	430	589	8e-51	BLAST
low complexity region	590	603	N/A	INTRINSIC
internal_repeat_1	611	635	5.49e-5	PROSPERO

Predicted Effect

possibly damaging
Transcript: ENSMUST00000148178
AA Change: R590S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000120115
Gene: ENSMUSG00000059208
AA Change: R590S

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:HnRNP_M	40	69	2.2e-22	PFAM
RRM	71	144	2.35e-20	SMART
low complexity region	164	175	N/A	INTRINSIC
low complexity region	176	193	N/A	INTRINSIC
RRM	204	276	1.66e-20	SMART
low complexity region	296	313	N/A	INTRINSIC
internal_repeat_2	332	432	6.64e-5	PROSPERO
internal_repeat_2	479	581	6.64e-5	PROSPERO
low complexity region	591	602	N/A	INTRINSIC
low complexity region	606	616	N/A	INTRINSIC
low complexity region	629	642	N/A	INTRINSIC
RRM	653	724	1.51e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148258

SMART Domains

Protein: ENSMUSP00000123580
Gene: ENSMUSG00000059208

Domain	Start	End	E-Value	Type
RRM	21	93	1.66e-20	SMART
low complexity region	113	130	N/A	INTRINSIC
low complexity region	146	167	N/A	INTRINSIC
low complexity region	196	202	N/A	INTRINSIC
internal_repeat_1	206	227	9.85e-5	PROSPERO
internal_repeat_1	221	238	9.85e-5	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163245

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166215

Meta Mutation Damage Score

0.1617

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.3%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs. This protein also constitutes a monomer of the N-acetylglucosamine-specific receptor which is postulated to trigger selective recycling of immature GlcNAc-bearing thyroglobulin molecules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	T	9: 108,395,299	D136V	probably damaging	Het
Ankrd17	G	A	5: 90,300,032	R217W	probably damaging	Het
Ankrd23	A	T	1: 36,531,987	H102Q	probably damaging	Het
Arfip2	G	T	7: 105,637,944	R138S	probably damaging	Het
Arhgap27	A	T	11: 103,339,123		probably null	Het
Atg2a	T	C	19: 6,257,533	L1499P	probably damaging	Het
Bnc2	A	G	4: 84,276,179	S110P	probably damaging	Het
Ccdc171	T	C	4: 83,558,592		probably benign	Het
Ccdc7a	A	G	8: 128,980,054		probably benign	Het
Chd5	T	C	4: 152,383,311	S1689P	probably benign	Het
Corin	A	G	5: 72,372,182	C212R	probably damaging	Het
Cyp2c65	A	G	19: 39,061,153	I42V	probably benign	Het
Cyp3a25	G	A	5: 145,991,456	R260C	probably damaging	Het
Dock6	T	C	9: 21,845,791	Y116C	probably damaging	Het
Eif3a	A	G	19: 60,763,218		probably benign	Het
Epop	T	C	11: 97,628,317	D322G	probably damaging	Het
Eps8l3	T	A	3: 107,890,688		probably benign	Het
Exph5	T	C	9: 53,376,625	S1669P	possibly damaging	Het
Faah	A	T	4: 115,999,626		probably benign	Het
Fanca	A	G	8: 123,303,985	C453R	probably benign	Het
Fcgbp	T	A	7: 28,086,235	C366S	probably damaging	Het
Fmn2	A	G	1: 174,502,415	T124A	unknown	Het
Foxi3	C	T	6: 70,957,012	S161L	probably damaging	Het
Foxo3	A	T	10: 42,197,024	V499E	probably damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gbgt1	T	C	2: 28,503,170	V90A	probably damaging	Het
Gm839	A	C	6: 89,212,599		noncoding transcript	Het
Gtf3c2	T	C	5: 31,169,123	E348G	possibly damaging	Het
Hspa1l	A	G	17: 34,978,223	T413A	possibly damaging	Het
Hspg2	T	C	4: 137,542,530	Y2297H	probably damaging	Het
Ighv1-81	T	A	12: 115,920,473	I53L	probably benign	Het
Kcnj11	C	T	7: 46,099,120	V260I	probably benign	Het
Krt84	A	G	15: 101,530,254	V266A	probably benign	Het
Lgals3bp	T	C	11: 118,393,955	Y266C	probably damaging	Het
Lrrc41	T	C	4: 116,089,324	V412A	possibly damaging	Het
Map4k4	A	T	1: 40,017,225	E1023D	probably damaging	Het
Mark3	T	A	12: 111,618,324	L118*	probably null	Het
Mrgpra9	T	A	7: 47,235,011	T303S	possibly damaging	Het
Mterf4	T	C	1: 93,304,925	E68G	probably benign	Het
Nckap5	A	C	1: 126,528,641		probably benign	Het
Nox3	T	A	17: 3,669,894	T339S	probably damaging	Het
Nrip2	A	C	6: 128,408,374	H256P	probably benign	Het
Oas1d	T	C	5: 120,915,768	V97A	probably benign	Het
Obox2	T	A	7: 15,397,177		probably null	Het
Olfr979	T	C	9: 40,001,023		probably null	Het
Opa1	T	C	16: 29,648,973	F989S	possibly damaging	Het
Padi1	T	A	4: 140,824,847	I429F	probably damaging	Het
Paics	A	G	5: 76,961,204	D163G	probably damaging	Het
Pik3c2b	G	T	1: 133,099,626	E1288*	probably null	Het
Prdm16	A	T	4: 154,341,552	V593D	possibly damaging	Het
Prpf39	A	G	12: 65,044,056	I165M	possibly damaging	Het
Pth2r	A	G	1: 65,321,984	T26A	probably benign	Het
Ptpn21	T	C	12: 98,715,195		probably null	Het
Rab44	C	T	17: 29,139,555	A239V	probably benign	Het
Rtcb	T	C	10: 85,955,736	N52S	probably benign	Het
Sapcd2	T	A	2: 25,373,566		probably null	Het
Scaf11	T	C	15: 96,418,242	E1147G	possibly damaging	Het
Selenoo	T	C	15: 89,099,678	Y595H	probably damaging	Het
Slc2a5	G	T	4: 150,120,742	E3*	probably null	Het
Snw1	A	G	12: 87,452,658	V391A	probably benign	Het
Sorbs2	A	G	8: 45,796,217	K755R	probably benign	Het
Sorbs3	G	T	14: 70,186,945	P513T	probably damaging	Het
Sowaha	T	A	11: 53,479,510	E133V	possibly damaging	Het
Srsf5	T	C	12: 80,947,301		probably benign	Het
St8sia5	T	A	18: 77,254,782	M396K	possibly damaging	Het
Tcp11l1	T	C	2: 104,681,785	I501V	probably benign	Het
Tert	A	G	13: 73,648,389	K1080E	possibly damaging	Het
Tescl	T	A	7: 24,333,898	M1L	possibly damaging	Het
Thop1	T	A	10: 81,073,367		probably null	Het
Tmtc4	T	C	14: 122,973,206	H80R	probably damaging	Het
Toe1	C	T	4: 116,804,532	S480N	probably damaging	Het
Trap1	C	A	16: 4,045,488	V557F	probably benign	Het
Trim30d	T	C	7: 104,483,357	E91G	probably benign	Het
Ttf1	C	T	2: 29,064,656	H11Y	possibly damaging	Het
Ttll8	C	A	15: 88,914,165	G789V	probably damaging	Het
Ulk4	A	G	9: 121,258,732	F298S	probably benign	Het
Wwc1	C	T	11: 35,889,400	A243T	probably benign	Het
Zfp248	A	C	6: 118,429,826	H267Q	possibly damaging	Het
Zfyve26	T	A	12: 79,275,011	M945L	probably benign	Het
Zufsp	T	C	10: 33,949,438	D16G	probably damaging	Het

Other mutations in Hnrnpm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00869:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00870:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00886:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00898:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00900:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00901:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00905:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00907:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00908:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00911:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00912:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00920:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00921:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00922:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00923:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00924:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00926:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00927:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00928:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00929:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00930:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00931:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00932:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00935:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00938:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00945:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00950:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00952:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00953:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00954:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00955:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00956:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00957:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00958:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00959:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL00960:Hnrnpm	APN	17	33649902	missense	probably damaging	0.99
IGL01301:Hnrnpm	APN	17	33669168	critical splice donor site	probably null
IGL02152:Hnrnpm	APN	17	33658412	missense	probably damaging	1.00
IGL02319:Hnrnpm	APN	17	33649950	missense	probably damaging	0.98
IGL02487:Hnrnpm	APN	17	33648813	missense	probably damaging	1.00
IGL03099:Hnrnpm	APN	17	33669172	missense	probably damaging	1.00
ANU18:Hnrnpm	UTSW	17	33669168	critical splice donor site	probably null
E0370:Hnrnpm	UTSW	17	33658922	splice site	probably benign
R0153:Hnrnpm	UTSW	17	33646515	missense	probably damaging	0.99
R0254:Hnrnpm	UTSW	17	33652268	splice site	probably null
R0606:Hnrnpm	UTSW	17	33658390	missense	probably damaging	0.97
R0940:Hnrnpm	UTSW	17	33650002	missense	probably damaging	1.00
R1216:Hnrnpm	UTSW	17	33649713	missense	probably damaging	0.99
R1392:Hnrnpm	UTSW	17	33658415	missense	possibly damaging	0.62
R1392:Hnrnpm	UTSW	17	33658415	missense	possibly damaging	0.62
R1454:Hnrnpm	UTSW	17	33666488	splice site	probably benign
R2011:Hnrnpm	UTSW	17	33664624	missense	probably damaging	1.00
R4678:Hnrnpm	UTSW	17	33650211	missense	possibly damaging	0.54
R7456:Hnrnpm	UTSW	17	33646648	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TTTCTCACAAATATCTGGCAGGC -3'
(R):5'- GCCTAAGCATGGATCGGATG -3'

Sequencing Primer
(F):5'- AAATATCTGGCAGGCCTTCC -3'
(R):5'- TAAGCATGGATCGGATGGTGCC -3'

Posted On

2016-04-15