Incidental Mutation 'R4907:Spata21'
ID379095
Institutional Source Beutler Lab
Gene Symbol Spata21
Ensembl Gene ENSMUSG00000045004
Gene Namespermatogenesis associated 21
Synonyms
MMRRC Submission 042509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4907 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141088333-141112760 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 141097121 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051907]
Predicted Effect probably null
Transcript: ENSMUST00000051907
SMART Domains Protein: ENSMUSP00000053080
Gene: ENSMUSG00000045004

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 245 251 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
SCOP:d1mr8a_ 428 494 7e-13 SMART
PDB:2RRT|A 432 494 2e-7 PDB
low complexity region 524 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 98% (89/91)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik G T 1: 57,383,191 G242V probably damaging Het
4933412E24Rik T C 15: 60,016,108 E161G probably benign Het
Abcc5 A G 16: 20,376,546 S734P possibly damaging Het
Actn1 T G 12: 80,181,414 H394P probably damaging Het
Adam8 A T 7: 139,989,373 D144E probably benign Het
Ankrd50 T A 3: 38,454,973 K1082* probably null Het
Ankrd50 A T 3: 38,456,675 N514K probably damaging Het
Atp4a A G 7: 30,719,092 I602V possibly damaging Het
Baz2a A G 10: 128,110,808 T64A probably damaging Het
Btbd19 A G 4: 117,120,567 probably benign Het
Casz1 T A 4: 148,944,541 S1148T probably damaging Het
Ccdc18 T A 5: 108,136,141 D103E probably benign Het
Cd209d T C 8: 3,877,948 N52S probably benign Het
Cdh7 T A 1: 110,138,323 Y776N probably damaging Het
Cdk14 A G 5: 5,249,140 V101A probably damaging Het
Cldn22 T C 8: 47,824,707 V60A probably benign Het
Clec10a G A 11: 70,169,971 G183D probably benign Het
Cnga3 T C 1: 37,241,942 probably null Het
Cts3 A T 13: 61,566,820 F224I probably benign Het
Fbxo40 A G 16: 36,969,702 Y349H probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gm10029 A T 13: 6,662,556 noncoding transcript Het
Gm14399 T A 2: 175,131,389 probably benign Het
Gm9932 T C 5: 100,199,155 noncoding transcript Het
Immp1l A G 2: 105,937,117 Y107C probably damaging Het
Ism1 G T 2: 139,678,752 G28V probably benign Het
Klf1 C A 8: 84,903,185 S213* probably null Het
Krt12 T C 11: 99,418,362 E329G probably damaging Het
Lama2 A T 10: 27,164,946 N1460K probably benign Het
Llgl2 T A 11: 115,853,974 Y932* probably null Het
Lrrc7 T C 3: 158,161,240 I955V probably damaging Het
Ltbp1 A G 17: 75,005,904 R7G probably benign Het
Mcm3ap A G 10: 76,493,441 E1152G probably damaging Het
Mgam2-ps T C 6: 40,834,743 noncoding transcript Het
Mical3 T A 6: 121,007,298 M206L probably benign Het
Mndal T G 1: 173,862,690 N358T probably damaging Het
Nckap5 A G 1: 126,026,152 S824P possibly damaging Het
Ndufb2 T C 6: 39,596,620 probably benign Het
Nfatc3 C A 8: 106,079,727 H401Q probably damaging Het
Npas2 T C 1: 39,361,985 V810A unknown Het
Nt5c2 A G 19: 46,896,539 V245A possibly damaging Het
Olfr1463 A G 19: 13,234,793 D181G probably damaging Het
Olfr350 A T 2: 36,850,258 I71F probably benign Het
Olfr615 A G 7: 103,561,034 M186V possibly damaging Het
Olfr651 A G 7: 104,553,311 R131G probably damaging Het
Olfr984 A T 9: 40,100,659 M277K probably benign Het
Otof A T 5: 30,378,661 probably null Het
Pck1 C T 2: 173,157,023 T358I probably damaging Het
Pclo T C 5: 14,680,051 probably benign Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pgr G A 9: 8,947,043 probably benign Het
Pkd1l3 T A 8: 109,640,843 V1224E probably damaging Het
Pkd2l1 A G 19: 44,154,142 V487A possibly damaging Het
Pkhd1 T C 1: 20,209,226 D2956G probably damaging Het
Rexo2 A T 9: 48,479,403 probably null Het
Rgs22 T A 15: 36,087,424 L573F possibly damaging Het
Rufy3 T G 5: 88,584,192 I18S possibly damaging Het
Slc30a9 T C 5: 67,346,162 L393P probably damaging Het
Snw1 T C 12: 87,459,489 I214V probably benign Het
Sorbs1 G A 19: 40,340,047 Q595* probably null Het
Ss18l1 G T 2: 180,063,399 probably null Het
Tmem163 A T 1: 127,519,370 L176H probably damaging Het
Tpd52 T C 3: 8,944,608 probably null Het
Tpsab1 T A 17: 25,343,462 Y297F possibly damaging Het
Trim55 A G 3: 19,674,374 T450A probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Txndc11 A T 16: 11,088,534 H377Q probably benign Het
Usp17la A G 7: 104,861,148 Y320C probably damaging Het
Vmn2r109 T C 17: 20,550,086 N547D probably damaging Het
Vmn2r54 A T 7: 12,616,223 probably null Het
Wdr33 T C 18: 31,906,993 *1331Q probably null Het
Wdr34 A G 2: 30,032,460 probably null Het
Wdr90 T A 17: 25,860,650 probably benign Het
Xpo7 T C 14: 70,670,629 M903V probably benign Het
Zfhx3 T A 8: 108,793,354 S369R probably damaging Het
Zfp808 T C 13: 62,171,473 F172S possibly damaging Het
Zfp821 A G 8: 109,723,993 E55G probably benign Het
Zfp964 T C 8: 69,663,322 Y191H possibly damaging Het
Zfyve1 T C 12: 83,574,872 T250A probably damaging Het
Other mutations in Spata21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Spata21 APN 4 141111364 unclassified probably null
IGL02679:Spata21 APN 4 141111265 unclassified probably benign
R1772:Spata21 UTSW 4 141111296 missense possibly damaging 0.79
R1894:Spata21 UTSW 4 141111381 missense possibly damaging 0.53
R1950:Spata21 UTSW 4 141111405 missense probably damaging 0.99
R2015:Spata21 UTSW 4 141107329 nonsense probably null
R2093:Spata21 UTSW 4 141096966 missense probably benign 0.04
R2911:Spata21 UTSW 4 141103082 missense possibly damaging 0.46
R4809:Spata21 UTSW 4 141097120 critical splice donor site probably null
R4897:Spata21 UTSW 4 141104950 missense probably damaging 0.99
R4921:Spata21 UTSW 4 141112091 missense probably damaging 1.00
R5269:Spata21 UTSW 4 141103021 missense probably damaging 1.00
R5380:Spata21 UTSW 4 141107185 missense probably damaging 1.00
R5602:Spata21 UTSW 4 141096899 missense probably benign
R6982:Spata21 UTSW 4 141096873 missense possibly damaging 0.71
R7503:Spata21 UTSW 4 141095303 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAGCCACTGAAGAATAACTCCC -3'
(R):5'- AGTTTGAGGTTAGCGCACA -3'

Sequencing Primer
(F):5'- TAACTCCCCCAGTGAAGCAGG -3'
(R):5'- TAGTGGCCAGCACCTTTAAC -3'
Posted On2016-04-15