Incidental Mutation 'R4907:Ccdc18'
ID 379104
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Name coiled-coil domain containing 18
Synonyms 1700021E15Rik, 4932411G06Rik
MMRRC Submission 042509-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4907 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 108280741-108381494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108284007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 103 (D103E)
Ref Sequence ENSEMBL: ENSMUSP00000142963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002837] [ENSMUST00000047677] [ENSMUST00000061203] [ENSMUST00000117759] [ENSMUST00000118036] [ENSMUST00000119437] [ENSMUST00000197718] [ENSMUST00000119784]
AlphaFold Q640L5
Predicted Effect probably benign
Transcript: ENSMUST00000002837
SMART Domains Protein: ENSMUSP00000002837
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EMP24_GP25L 35 222 5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047677
AA Change: D103E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: D103E

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061203
SMART Domains Protein: ENSMUSP00000056449
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 112 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117759
SMART Domains Protein: ENSMUSP00000112612
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 100 4.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118036
SMART Domains Protein: ENSMUSP00000113922
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 99 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119437
SMART Domains Protein: ENSMUSP00000112406
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EMP24_GP25L 35 160 9.65e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200463
Predicted Effect probably benign
Transcript: ENSMUST00000197718
AA Change: D103E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142963
Gene: ENSMUSG00000056531
AA Change: D103E

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119784
SMART Domains Protein: ENSMUSP00000113422
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 96 2.4e-14 PFAM
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 98% (89/91)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik G T 1: 57,422,350 (GRCm39) G242V probably damaging Het
4933412E24Rik T C 15: 59,887,957 (GRCm39) E161G probably benign Het
Abcc5 A G 16: 20,195,296 (GRCm39) S734P possibly damaging Het
Actn1 T G 12: 80,228,188 (GRCm39) H394P probably damaging Het
Adam8 A T 7: 139,569,286 (GRCm39) D144E probably benign Het
Ankrd50 A T 3: 38,510,824 (GRCm39) N514K probably damaging Het
Ankrd50 T A 3: 38,509,122 (GRCm39) K1082* probably null Het
Atp4a A G 7: 30,418,517 (GRCm39) I602V possibly damaging Het
Baz2a A G 10: 127,946,677 (GRCm39) T64A probably damaging Het
Btbd19 A G 4: 116,977,764 (GRCm39) probably benign Het
Casz1 T A 4: 149,028,998 (GRCm39) S1148T probably damaging Het
Cd209d T C 8: 3,927,948 (GRCm39) N52S probably benign Het
Cdh20 T A 1: 110,066,053 (GRCm39) Y776N probably damaging Het
Cdk14 A G 5: 5,299,140 (GRCm39) V101A probably damaging Het
Cldn22 T C 8: 48,277,742 (GRCm39) V60A probably benign Het
Clec10a G A 11: 70,060,797 (GRCm39) G183D probably benign Het
Cnga3 T C 1: 37,281,023 (GRCm39) probably null Het
Cts3 A T 13: 61,714,634 (GRCm39) F224I probably benign Het
Dync2i2 A G 2: 29,922,472 (GRCm39) probably null Het
Fbxo40 A G 16: 36,790,064 (GRCm39) Y349H probably benign Het
Flt1 C A 5: 147,620,749 (GRCm39) A132S probably benign Het
Gm10029 A T 13: 6,712,592 (GRCm39) noncoding transcript Het
Gm14399 T A 2: 174,973,182 (GRCm39) probably benign Het
Gm9932 T C 5: 100,347,014 (GRCm39) noncoding transcript Het
Immp1l A G 2: 105,767,462 (GRCm39) Y107C probably damaging Het
Ism1 G T 2: 139,520,672 (GRCm39) G28V probably benign Het
Klf1 C A 8: 85,629,814 (GRCm39) S213* probably null Het
Krt12 T C 11: 99,309,188 (GRCm39) E329G probably damaging Het
Lama2 A T 10: 27,040,942 (GRCm39) N1460K probably benign Het
Llgl2 T A 11: 115,744,800 (GRCm39) Y932* probably null Het
Lrrc7 T C 3: 157,866,877 (GRCm39) I955V probably damaging Het
Ltbp1 A G 17: 75,312,899 (GRCm39) R7G probably benign Het
Mcm3ap A G 10: 76,329,275 (GRCm39) E1152G probably damaging Het
Mgam2-ps T C 6: 40,811,677 (GRCm39) noncoding transcript Het
Mical3 T A 6: 120,984,259 (GRCm39) M206L probably benign Het
Mndal T G 1: 173,690,256 (GRCm39) N358T probably damaging Het
Nckap5 A G 1: 125,953,889 (GRCm39) S824P possibly damaging Het
Ndufb2 T C 6: 39,573,554 (GRCm39) probably benign Het
Nfatc3 C A 8: 106,806,359 (GRCm39) H401Q probably damaging Het
Npas2 T C 1: 39,401,066 (GRCm39) V810A unknown Het
Nt5c2 A G 19: 46,884,978 (GRCm39) V245A possibly damaging Het
Or1j4 A T 2: 36,740,270 (GRCm39) I71F probably benign Het
Or4d5 A T 9: 40,011,955 (GRCm39) M277K probably benign Het
Or51ah3 A G 7: 103,210,241 (GRCm39) M186V possibly damaging Het
Or52h9 A G 7: 104,202,518 (GRCm39) R131G probably damaging Het
Or5b109 A G 19: 13,212,157 (GRCm39) D181G probably damaging Het
Otof A T 5: 30,536,005 (GRCm39) probably null Het
Pck1 C T 2: 172,998,816 (GRCm39) T358I probably damaging Het
Pclo T C 5: 14,730,065 (GRCm39) probably benign Het
Pgm2 T A 5: 64,261,221 (GRCm39) F238L probably benign Het
Pgr G A 9: 8,947,044 (GRCm39) probably benign Het
Pkd1l3 T A 8: 110,367,475 (GRCm39) V1224E probably damaging Het
Pkd2l1 A G 19: 44,142,581 (GRCm39) V487A possibly damaging Het
Pkhd1 T C 1: 20,279,450 (GRCm39) D2956G probably damaging Het
Rexo2 A T 9: 48,390,703 (GRCm39) probably null Het
Rgs22 T A 15: 36,087,570 (GRCm39) L573F possibly damaging Het
Rufy3 T G 5: 88,732,051 (GRCm39) I18S possibly damaging Het
Slc30a9 T C 5: 67,503,505 (GRCm39) L393P probably damaging Het
Snw1 T C 12: 87,506,259 (GRCm39) I214V probably benign Het
Sorbs1 G A 19: 40,328,491 (GRCm39) Q595* probably null Het
Spata21 T A 4: 140,824,432 (GRCm39) probably null Het
Ss18l1 G T 2: 179,705,192 (GRCm39) probably null Het
Tmem163 A T 1: 127,447,107 (GRCm39) L176H probably damaging Het
Tpd52 T C 3: 9,009,668 (GRCm39) probably null Het
Tpsab1 T A 17: 25,562,436 (GRCm39) Y297F possibly damaging Het
Trim55 A G 3: 19,728,538 (GRCm39) T450A probably benign Het
Ttf1 C T 2: 28,954,668 (GRCm39) H11Y possibly damaging Het
Txndc11 A T 16: 10,906,398 (GRCm39) H377Q probably benign Het
Usp17la A G 7: 104,510,355 (GRCm39) Y320C probably damaging Het
Vmn2r109 T C 17: 20,770,348 (GRCm39) N547D probably damaging Het
Vmn2r54 A T 7: 12,350,150 (GRCm39) probably null Het
Wdr33 T C 18: 32,040,046 (GRCm39) *1331Q probably null Het
Wdr90 T A 17: 26,079,624 (GRCm39) probably benign Het
Xpo7 T C 14: 70,908,069 (GRCm39) M903V probably benign Het
Zfhx3 T A 8: 109,519,986 (GRCm39) S369R probably damaging Het
Zfp808 T C 13: 62,319,287 (GRCm39) F172S possibly damaging Het
Zfp821 A G 8: 110,450,625 (GRCm39) E55G probably benign Het
Zfp964 T C 8: 70,115,972 (GRCm39) Y191H possibly damaging Het
Zfyve1 T C 12: 83,621,646 (GRCm39) T250A probably damaging Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108,328,391 (GRCm39) missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108,328,753 (GRCm39) missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108,350,052 (GRCm39) splice site probably benign
IGL01718:Ccdc18 APN 5 108,349,214 (GRCm39) missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108,349,977 (GRCm39) missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108,296,788 (GRCm39) missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108,283,918 (GRCm39) missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108,319,614 (GRCm39) missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108,283,835 (GRCm39) splice site probably benign
IGL02880:Ccdc18 APN 5 108,283,310 (GRCm39) missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108,376,767 (GRCm39) missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108,359,997 (GRCm39) missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108,306,485 (GRCm39) missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108,309,566 (GRCm39) missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108,321,627 (GRCm39) missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108,321,655 (GRCm39) missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108,322,830 (GRCm39) missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108,328,282 (GRCm39) missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108,322,853 (GRCm39) missense probably damaging 1.00
R0648:Ccdc18 UTSW 5 108,283,426 (GRCm39) missense probably damaging 0.99
R0666:Ccdc18 UTSW 5 108,311,530 (GRCm39) missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108,349,982 (GRCm39) nonsense probably null
R1509:Ccdc18 UTSW 5 108,336,844 (GRCm39) missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108,339,843 (GRCm39) missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108,360,054 (GRCm39) missense probably benign
R1663:Ccdc18 UTSW 5 108,363,956 (GRCm39) missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108,341,668 (GRCm39) missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108,368,703 (GRCm39) missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108,343,908 (GRCm39) missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108,376,861 (GRCm39) missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4079:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4244:Ccdc18 UTSW 5 108,296,838 (GRCm39) nonsense probably null
R4409:Ccdc18 UTSW 5 108,368,708 (GRCm39) nonsense probably null
R4428:Ccdc18 UTSW 5 108,283,943 (GRCm39) missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108,309,395 (GRCm39) missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108,376,826 (GRCm39) missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108,283,307 (GRCm39) missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108,339,869 (GRCm39) missense probably benign
R5039:Ccdc18 UTSW 5 108,306,514 (GRCm39) critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108,288,740 (GRCm39) missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108,354,594 (GRCm39) missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108,311,625 (GRCm39) missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108,319,484 (GRCm39) missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108,322,753 (GRCm39) missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108,309,448 (GRCm39) missense probably benign
R6359:Ccdc18 UTSW 5 108,283,391 (GRCm39) missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108,322,820 (GRCm39) missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108,349,214 (GRCm39) missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108,309,612 (GRCm39) missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108,339,790 (GRCm39) missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108,286,796 (GRCm39) missense probably benign
R6664:Ccdc18 UTSW 5 108,315,966 (GRCm39) nonsense probably null
R6836:Ccdc18 UTSW 5 108,345,833 (GRCm39) missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108,309,401 (GRCm39) missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108,321,728 (GRCm39) critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108,309,554 (GRCm39) missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108,341,664 (GRCm39) missense probably benign
R7087:Ccdc18 UTSW 5 108,343,988 (GRCm39) missense probably benign
R7117:Ccdc18 UTSW 5 108,296,835 (GRCm39) missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108,315,972 (GRCm39) missense probably benign
R7382:Ccdc18 UTSW 5 108,286,873 (GRCm39) missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108,368,716 (GRCm39) missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108,354,483 (GRCm39) nonsense probably null
R7506:Ccdc18 UTSW 5 108,311,605 (GRCm39) missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108,376,915 (GRCm39) critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108,376,528 (GRCm39) missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108,296,907 (GRCm39) critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108,328,699 (GRCm39) missense probably benign 0.00
R8017:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8019:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8172:Ccdc18 UTSW 5 108,311,640 (GRCm39) critical splice donor site probably null
R8177:Ccdc18 UTSW 5 108,345,661 (GRCm39) missense possibly damaging 0.65
R8344:Ccdc18 UTSW 5 108,309,369 (GRCm39) missense possibly damaging 0.88
R8351:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8415:Ccdc18 UTSW 5 108,363,899 (GRCm39) missense probably damaging 1.00
R8451:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8547:Ccdc18 UTSW 5 108,345,725 (GRCm39) missense probably damaging 1.00
R8725:Ccdc18 UTSW 5 108,328,283 (GRCm39) missense possibly damaging 0.66
R9137:Ccdc18 UTSW 5 108,296,856 (GRCm39) missense probably damaging 0.98
R9391:Ccdc18 UTSW 5 108,376,770 (GRCm39) missense probably benign 0.02
R9418:Ccdc18 UTSW 5 108,303,669 (GRCm39) missense probably damaging 1.00
R9536:Ccdc18 UTSW 5 108,286,792 (GRCm39) missense probably benign 0.01
R9565:Ccdc18 UTSW 5 108,339,800 (GRCm39) missense probably damaging 0.99
RF013:Ccdc18 UTSW 5 108,368,582 (GRCm39) missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108,339,788 (GRCm39) missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108,360,063 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAACACAGTCTTATGCTCATAAC -3'
(R):5'- GATCCAACACACTTTTCTGACC -3'

Sequencing Primer
(F):5'- CACAGTCTTATGCTCATAACTTTGG -3'
(R):5'- TCTGACCTCTACATCATATGCAGAC -3'
Posted On 2016-04-15