Incidental Mutation 'R0243:Asic1'
ID37911
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Nameacid-sensing (proton-gated) ion channel 1
SynonymsASIC1a, ASICalpha, B530003N02Rik, ASIC, Accn2, BNaC2, ASIC1 beta
MMRRC Submission 038481-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0243 (G1)
Quality Score138
Status Validated
Chromosome15
Chromosomal Location99670368-99701130 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 99698617 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000023759] [ENSMUST00000163472] [ENSMUST00000228185] [ENSMUST00000228984] [ENSMUST00000229236] [ENSMUST00000229845] [ENSMUST00000230530]
Predicted Effect probably benign
Transcript: ENSMUST00000023758
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023759
SMART Domains Protein: ENSMUSP00000023759
Gene: ENSMUSG00000023018

DomainStartEndE-ValueType
low complexity region 9 38 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Blast:KISc 124 271 2e-43 BLAST
SWIB 291 370 1.97e-35 SMART
Blast:MYSc 452 498 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163472
SMART Domains Protein: ENSMUSP00000128823
Gene: ENSMUSG00000091604

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
low complexity region 44 78 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228012
Predicted Effect probably benign
Transcript: ENSMUST00000228185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228610
Predicted Effect probably benign
Transcript: ENSMUST00000228984
Predicted Effect probably benign
Transcript: ENSMUST00000229236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229686
Predicted Effect probably benign
Transcript: ENSMUST00000229845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229968
Predicted Effect probably benign
Transcript: ENSMUST00000230530
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 98% (148/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T G 5: 63,898,463 Y181D probably benign Het
1110034G24Rik T C 2: 132,750,639 V202A probably benign Het
1700029H14Rik A G 8: 13,554,715 V196A possibly damaging Het
2410004B18Rik A G 3: 145,938,078 D7G probably damaging Het
2810474O19Rik T C 6: 149,326,241 Y262H probably damaging Het
Acap1 A G 11: 69,885,426 V249A probably damaging Het
Acat2 A T 17: 12,944,021 D313E probably benign Het
Actn4 T C 7: 28,905,398 T325A probably benign Het
Adamdec1 C T 14: 68,581,958 probably null Het
Adat2 A G 10: 13,553,293 T10A probably benign Het
Aff4 T A 11: 53,397,858 S400R possibly damaging Het
Agbl2 C T 2: 90,791,481 P104L possibly damaging Het
Alox12 G T 11: 70,242,716 T594K possibly damaging Het
Als2 C A 1: 59,215,387 K270N probably benign Het
Ankhd1 T A 18: 36,634,734 C1235S probably damaging Het
Ankrd24 T A 10: 81,634,944 I69N probably damaging Het
Aox4 G A 1: 58,213,076 V37I probably benign Het
Arfgap3 A G 15: 83,330,513 probably benign Het
Arhgef4 T A 1: 34,806,999 probably null Het
Atp8b5 A G 4: 43,366,057 N776S probably benign Het
Bbs7 A G 3: 36,605,734 I184T probably benign Het
Bbs9 A T 9: 22,514,001 H117L probably damaging Het
Bnip2 T C 9: 69,995,505 W10R probably damaging Het
Brd4 G T 17: 32,224,123 Q175K probably benign Het
Bysl A T 17: 47,606,896 V124E possibly damaging Het
Cadm3 A G 1: 173,346,573 probably benign Het
Cc2d2a T C 5: 43,696,638 probably benign Het
Ccdc134 G T 15: 82,140,946 E215D probably damaging Het
Celsr3 G T 9: 108,843,724 probably benign Het
Cntn5 T A 9: 9,781,775 D428V probably damaging Het
Cog1 A G 11: 113,656,995 probably benign Het
Col11a2 G T 17: 34,062,546 probably benign Het
Cyp4f13 G A 17: 32,924,969 probably benign Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Dffb T A 4: 153,965,378 K343* probably null Het
Dnah9 T A 11: 65,911,852 I224F possibly damaging Het
Dolk A T 2: 30,286,019 C5S probably benign Het
Ebf1 A T 11: 44,869,088 probably benign Het
Elac1 A G 18: 73,742,363 L199P probably damaging Het
Elmod1 A C 9: 53,935,547 probably benign Het
Ep400 A C 5: 110,724,407 probably benign Het
F10 A T 8: 13,048,196 N133I probably damaging Het
Fasn A G 11: 120,815,315 Y1068H probably benign Het
Fbxo24 T C 5: 137,624,557 E12G probably damaging Het
Fer G T 17: 64,078,946 L304F probably benign Het
Filip1 A C 9: 79,819,003 L778R probably damaging Het
Fli1 A T 9: 32,423,981 I385N probably benign Het
Fpgs A T 2: 32,692,494 L89* probably null Het
Gab2 T G 7: 97,299,241 I346R probably damaging Het
Gm10764 G A 10: 87,290,979 G83R unknown Het
Gpr83 G T 9: 14,864,842 C153F possibly damaging Het
Gtf3c3 A G 1: 54,403,536 L783P possibly damaging Het
Gys2 A G 6: 142,472,668 probably benign Het
Heatr9 C T 11: 83,513,338 V378I possibly damaging Het
Helz A T 11: 107,637,914 Y920F possibly damaging Het
Inpp5f A T 7: 128,695,183 Q459L probably damaging Het
Ints12 T C 3: 133,109,045 S338P probably benign Het
Kif13a T C 13: 46,791,351 T925A probably benign Het
Kif1a C T 1: 93,042,093 V1051I probably damaging Het
Kif7 T A 7: 79,699,560 H1119L possibly damaging Het
Kmt2d C T 15: 98,850,137 probably benign Het
Krt90 C T 15: 101,562,675 G51S possibly damaging Het
Krtap31-2 A T 11: 99,936,746 I135F possibly damaging Het
Lrp2 T C 2: 69,428,630 E4572G probably benign Het
Mapk8ip1 T C 2: 92,385,944 E493G probably damaging Het
Matk T G 10: 81,258,492 L28V probably benign Het
Mcc T A 18: 44,759,299 T83S probably benign Het
Mtch1 A T 17: 29,340,106 M204K possibly damaging Het
Muc4 T G 16: 32,765,746 C2622G possibly damaging Het
Myo5a G A 9: 75,186,123 probably null Het
Myoz3 T C 18: 60,578,951 Y185C probably damaging Het
Nnmt A G 9: 48,592,138 V196A probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nup214 T A 2: 31,998,057 probably benign Het
Olfr1261 T A 2: 89,993,806 F138I probably benign Het
Olfr1383 T C 11: 49,523,912 L63P probably damaging Het
Olfr169 T G 16: 19,566,294 E196D probably damaging Het
Pank3 T C 11: 35,781,716 probably benign Het
Parm1 A T 5: 91,594,294 N174Y possibly damaging Het
Pcgf2 A T 11: 97,692,418 probably null Het
Pclo A T 5: 14,775,420 K4661M unknown Het
Pcsk7 A C 9: 45,916,059 S375R probably damaging Het
Pdzrn4 G T 15: 92,770,319 S784I possibly damaging Het
Pex6 T A 17: 46,723,737 probably null Het
Pi4ka C T 16: 17,297,635 V1384M probably benign Het
Polr3f T A 2: 144,536,275 probably benign Het
Ppp2r3a A T 9: 101,212,284 V280E probably damaging Het
Prdm14 C T 1: 13,122,448 G356R probably damaging Het
Prepl A G 17: 85,065,038 probably null Het
Primpol T C 8: 46,599,814 D154G probably damaging Het
Ptchd4 A C 17: 42,503,416 H736P probably damaging Het
Rab11fip1 A G 8: 27,152,225 S849P probably damaging Het
Rap1gap T A 4: 137,719,351 D405E probably damaging Het
Rbm26 T C 14: 105,131,938 T686A probably benign Het
Rint1 A G 5: 23,816,932 probably benign Het
Rnasek G T 11: 70,238,440 Y62* probably null Het
Rnf17 T G 14: 56,482,084 N930K possibly damaging Het
Sap130 A G 18: 31,680,681 probably benign Het
Sectm1b T A 11: 121,055,785 I95F probably damaging Het
Sema4f A T 6: 82,939,466 I53N possibly damaging Het
Siglec1 T C 2: 131,085,476 T137A probably damaging Het
Six5 A C 7: 19,097,022 probably null Het
Slc22a30 A T 19: 8,345,357 I345N probably benign Het
Slc25a27 A T 17: 43,643,627 M316K probably benign Het
Slc2a8 A T 2: 32,980,104 probably benign Het
Snx1 G A 9: 66,101,326 probably benign Het
Spag17 A G 3: 100,085,368 T1727A probably benign Het
Spata20 T C 11: 94,481,646 D633G probably benign Het
Spock1 C T 13: 57,436,109 probably null Het
Sra1 A T 18: 36,675,706 Y291* probably null Het
Sspo C A 6: 48,493,186 P4520T probably damaging Het
Stat4 A G 1: 52,011,857 N25S probably benign Het
Tbx18 A T 9: 87,715,516 probably benign Het
Tctex1d2 A G 16: 32,426,887 D118G probably damaging Het
Tep1 T A 14: 50,846,987 I187F probably damaging Het
Tfap2b A T 1: 19,234,123 I368F probably damaging Het
Tmtc1 A T 6: 148,246,837 L711Q probably damaging Het
Tmx3 T A 18: 90,538,489 probably benign Het
Tnc G T 4: 63,970,420 T1803K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tpgs1 C T 10: 79,675,866 P281S probably benign Het
Trim45 A G 3: 100,929,844 R499G probably benign Het
Tulp3 A T 6: 128,325,958 Y299* probably null Het
Ube4a A T 9: 44,946,178 probably benign Het
Ubr3 T G 2: 69,951,405 S642R probably damaging Het
Vcpip1 A T 1: 9,747,206 Y317* probably null Het
Vmn1r115 G A 7: 20,844,402 T195I probably benign Het
Vmn1r226 G A 17: 20,687,577 V24I probably benign Het
Wdr41 C T 13: 95,017,406 A321V probably damaging Het
Wfdc5 T C 2: 164,178,835 N44D probably benign Het
Wnt7b C A 15: 85,558,902 probably null Het
Zfp108 T C 7: 24,261,783 S600P possibly damaging Het
Zfp385b A G 2: 77,415,728 probably null Het
Zfp395 T C 14: 65,386,480 S133P probably benign Het
Zfp407 T A 18: 84,558,711 M1426L probably damaging Het
Zfp641 T G 15: 98,289,127 N191T possibly damaging Het
Zfp687 T C 3: 95,011,553 S303G probably damaging Het
Zfp759 T A 13: 67,138,813 F143I possibly damaging Het
Zgrf1 G C 3: 127,615,446 E1690Q probably damaging Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01418:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01718:Asic1 APN 15 99672002 missense probably damaging 1.00
IGL01941:Asic1 APN 15 99699101 missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99697472 missense probably benign 0.01
IGL02097:Asic1 APN 15 99694686 splice site probably benign
IGL03028:Asic1 APN 15 99672157 missense probably benign 0.03
IGL03082:Asic1 APN 15 99696547 missense probably benign
IGL03183:Asic1 APN 15 99672017 missense probably benign 0.43
IGL03231:Asic1 APN 15 99699102 missense probably benign 0.42
R0111:Asic1 UTSW 15 99696983 missense probably damaging 1.00
R0316:Asic1 UTSW 15 99671938 missense probably benign 0.03
R0518:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0520:Asic1 UTSW 15 99695535 missense probably damaging 1.00
R0521:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0610:Asic1 UTSW 15 99698899 missense probably benign 0.14
R1034:Asic1 UTSW 15 99698058 missense probably damaging 1.00
R1666:Asic1 UTSW 15 99699125 missense probably damaging 1.00
R1796:Asic1 UTSW 15 99696654 missense probably null 0.99
R1993:Asic1 UTSW 15 99671884 missense probably damaging 1.00
R2130:Asic1 UTSW 15 99671875 missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99671965 missense probably benign
R2895:Asic1 UTSW 15 99696602 missense probably benign 0.22
R3793:Asic1 UTSW 15 99672025 nonsense probably null
R3848:Asic1 UTSW 15 99672933 missense probably benign 0.01
R5115:Asic1 UTSW 15 99672052 missense probably damaging 0.97
R5186:Asic1 UTSW 15 99698803 unclassified probably benign
R5187:Asic1 UTSW 15 99698803 unclassified probably benign
R5409:Asic1 UTSW 15 99698803 unclassified probably benign
R6011:Asic1 UTSW 15 99699079 missense probably benign 0.05
R6383:Asic1 UTSW 15 99698880 missense probably damaging 0.96
R7133:Asic1 UTSW 15 99672087 missense probably damaging 1.00
R7255:Asic1 UTSW 15 99697457 missense probably damaging 0.97
R7587:Asic1 UTSW 15 99695590 missense probably damaging 1.00
R8012:Asic1 UTSW 15 99696651 missense possibly damaging 0.92
R8030:Asic1 UTSW 15 99694841 missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99698087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGGCAGAACCTGCTCCATACG -3'
(R):5'- CGGTGCTTAATGACCTGGGAGATG -3'

Sequencing Primer
(F):5'- ATACGTCCGTCCTTGGAAAG -3'
(R):5'- ACCTGGGAGATGTTCAGGG -3'
Posted On2013-05-23