Incidental Mutation 'R4907:Llgl2'
ID379130
Institutional Source Beutler Lab
Gene Symbol Llgl2
Ensembl Gene ENSMUSG00000020782
Gene NameLLGL2 scribble cell polarity complex component
Synonyms9130006H11Rik
MMRRC Submission 042509-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R4907 (G1)
Quality Score199
Status Validated
Chromosome11
Chromosomal Location115824049-115855780 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 115853974 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 932 (Y932*)
Ref Sequence ENSEMBL: ENSMUSP00000136054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093911] [ENSMUST00000103032] [ENSMUST00000177736]
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103032
AA Change: Y908*
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: Y908*

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000128826
AA Change: Y57*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147878
Predicted Effect probably null
Transcript: ENSMUST00000177736
AA Change: Y932*
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: Y932*

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Meta Mutation Damage Score 0.9706 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik G T 1: 57,383,191 G242V probably damaging Het
4933412E24Rik T C 15: 60,016,108 E161G probably benign Het
Abcc5 A G 16: 20,376,546 S734P possibly damaging Het
Actn1 T G 12: 80,181,414 H394P probably damaging Het
Adam8 A T 7: 139,989,373 D144E probably benign Het
Ankrd50 T A 3: 38,454,973 K1082* probably null Het
Ankrd50 A T 3: 38,456,675 N514K probably damaging Het
Atp4a A G 7: 30,719,092 I602V possibly damaging Het
Baz2a A G 10: 128,110,808 T64A probably damaging Het
Btbd19 A G 4: 117,120,567 probably benign Het
Casz1 T A 4: 148,944,541 S1148T probably damaging Het
Ccdc18 T A 5: 108,136,141 D103E probably benign Het
Cd209d T C 8: 3,877,948 N52S probably benign Het
Cdh7 T A 1: 110,138,323 Y776N probably damaging Het
Cdk14 A G 5: 5,249,140 V101A probably damaging Het
Cldn22 T C 8: 47,824,707 V60A probably benign Het
Clec10a G A 11: 70,169,971 G183D probably benign Het
Cnga3 T C 1: 37,241,942 probably null Het
Cts3 A T 13: 61,566,820 F224I probably benign Het
Fbxo40 A G 16: 36,969,702 Y349H probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gm10029 A T 13: 6,662,556 noncoding transcript Het
Gm14399 T A 2: 175,131,389 probably benign Het
Gm9932 T C 5: 100,199,155 noncoding transcript Het
Immp1l A G 2: 105,937,117 Y107C probably damaging Het
Ism1 G T 2: 139,678,752 G28V probably benign Het
Klf1 C A 8: 84,903,185 S213* probably null Het
Krt12 T C 11: 99,418,362 E329G probably damaging Het
Lama2 A T 10: 27,164,946 N1460K probably benign Het
Lrrc7 T C 3: 158,161,240 I955V probably damaging Het
Ltbp1 A G 17: 75,005,904 R7G probably benign Het
Mcm3ap A G 10: 76,493,441 E1152G probably damaging Het
Mgam2-ps T C 6: 40,834,743 noncoding transcript Het
Mical3 T A 6: 121,007,298 M206L probably benign Het
Mndal T G 1: 173,862,690 N358T probably damaging Het
Nckap5 A G 1: 126,026,152 S824P possibly damaging Het
Ndufb2 T C 6: 39,596,620 probably benign Het
Nfatc3 C A 8: 106,079,727 H401Q probably damaging Het
Npas2 T C 1: 39,361,985 V810A unknown Het
Nt5c2 A G 19: 46,896,539 V245A possibly damaging Het
Olfr1463 A G 19: 13,234,793 D181G probably damaging Het
Olfr350 A T 2: 36,850,258 I71F probably benign Het
Olfr615 A G 7: 103,561,034 M186V possibly damaging Het
Olfr651 A G 7: 104,553,311 R131G probably damaging Het
Olfr984 A T 9: 40,100,659 M277K probably benign Het
Otof A T 5: 30,378,661 probably null Het
Pck1 C T 2: 173,157,023 T358I probably damaging Het
Pclo T C 5: 14,680,051 probably benign Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pgr G A 9: 8,947,043 probably benign Het
Pkd1l3 T A 8: 109,640,843 V1224E probably damaging Het
Pkd2l1 A G 19: 44,154,142 V487A possibly damaging Het
Pkhd1 T C 1: 20,209,226 D2956G probably damaging Het
Rexo2 A T 9: 48,479,403 probably null Het
Rgs22 T A 15: 36,087,424 L573F possibly damaging Het
Rufy3 T G 5: 88,584,192 I18S possibly damaging Het
Slc30a9 T C 5: 67,346,162 L393P probably damaging Het
Snw1 T C 12: 87,459,489 I214V probably benign Het
Sorbs1 G A 19: 40,340,047 Q595* probably null Het
Spata21 T A 4: 141,097,121 probably null Het
Ss18l1 G T 2: 180,063,399 probably null Het
Tmem163 A T 1: 127,519,370 L176H probably damaging Het
Tpd52 T C 3: 8,944,608 probably null Het
Tpsab1 T A 17: 25,343,462 Y297F possibly damaging Het
Trim55 A G 3: 19,674,374 T450A probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Txndc11 A T 16: 11,088,534 H377Q probably benign Het
Usp17la A G 7: 104,861,148 Y320C probably damaging Het
Vmn2r109 T C 17: 20,550,086 N547D probably damaging Het
Vmn2r54 A T 7: 12,616,223 probably null Het
Wdr33 T C 18: 31,906,993 *1331Q probably null Het
Wdr34 A G 2: 30,032,460 probably null Het
Wdr90 T A 17: 25,860,650 probably benign Het
Xpo7 T C 14: 70,670,629 M903V probably benign Het
Zfhx3 T A 8: 108,793,354 S369R probably damaging Het
Zfp808 T C 13: 62,171,473 F172S possibly damaging Het
Zfp821 A G 8: 109,723,993 E55G probably benign Het
Zfp964 T C 8: 69,663,322 Y191H possibly damaging Het
Zfyve1 T C 12: 83,574,872 T250A probably damaging Het
Other mutations in Llgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Llgl2 APN 11 115834884 missense probably benign 0.00
IGL01145:Llgl2 APN 11 115853805 missense probably benign
IGL01344:Llgl2 APN 11 115851193 missense probably benign 0.01
IGL01980:Llgl2 APN 11 115850025 missense probably damaging 1.00
IGL02220:Llgl2 APN 11 115845379 missense possibly damaging 0.64
IGL02341:Llgl2 APN 11 115851120 missense possibly damaging 0.70
IGL02399:Llgl2 APN 11 115844835 missense probably damaging 0.97
IGL02415:Llgl2 APN 11 115853285 missense probably damaging 0.98
IGL02632:Llgl2 APN 11 115844872 missense probably damaging 1.00
IGL02990:Llgl2 APN 11 115854333 missense probably benign 0.01
IGL03405:Llgl2 APN 11 115850842 missense probably benign 0.09
R0097:Llgl2 UTSW 11 115844497 nonsense probably null
R0166:Llgl2 UTSW 11 115844854 missense probably damaging 1.00
R0277:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0323:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0345:Llgl2 UTSW 11 115849992 splice site probably benign
R0614:Llgl2 UTSW 11 115850267 missense probably damaging 1.00
R0980:Llgl2 UTSW 11 115850001 missense probably damaging 1.00
R1387:Llgl2 UTSW 11 115853132 missense probably damaging 0.99
R1456:Llgl2 UTSW 11 115845499 missense probably benign 0.00
R1541:Llgl2 UTSW 11 115853121 missense probably benign 0.00
R1832:Llgl2 UTSW 11 115851100 missense probably damaging 1.00
R1950:Llgl2 UTSW 11 115851066 missense probably damaging 0.96
R2991:Llgl2 UTSW 11 115851120 missense probably benign 0.05
R4018:Llgl2 UTSW 11 115847612 missense probably benign 0.31
R4582:Llgl2 UTSW 11 115850706 missense possibly damaging 0.89
R4729:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R5000:Llgl2 UTSW 11 115844902 missense probably benign
R5016:Llgl2 UTSW 11 115853424 missense probably damaging 1.00
R5175:Llgl2 UTSW 11 115850721 missense probably damaging 1.00
R5857:Llgl2 UTSW 11 115850281 missense probably damaging 1.00
R6190:Llgl2 UTSW 11 115846986 missense probably benign 0.00
R6451:Llgl2 UTSW 11 115844941 missense probably damaging 0.99
R6804:Llgl2 UTSW 11 115843315 critical splice acceptor site probably null
R6909:Llgl2 UTSW 11 115850799 missense probably damaging 1.00
R7324:Llgl2 UTSW 11 115850730 missense possibly damaging 0.49
R7332:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R7715:Llgl2 UTSW 11 115849728 missense probably benign
R8038:Llgl2 UTSW 11 115851103 missense probably benign 0.17
R8069:Llgl2 UTSW 11 115853286 missense probably damaging 0.99
R8076:Llgl2 UTSW 11 115846929 missense possibly damaging 0.69
R8109:Llgl2 UTSW 11 115850793 missense possibly damaging 0.52
R8129:Llgl2 UTSW 11 115850911 splice site probably null
R8731:Llgl2 UTSW 11 115851190 missense probably benign 0.01
R8881:Llgl2 UTSW 11 115853040 missense probably benign 0.02
X0058:Llgl2 UTSW 11 115850637 missense probably damaging 0.99
Z1176:Llgl2 UTSW 11 115849554 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGCCAAACTGAAGCTGAAG -3'
(R):5'- AGAGAAAAGCGCTCGAACTC -3'

Sequencing Primer
(F):5'- AGTCGGTGTCGCCCACTTTG -3'
(R):5'- AGCCCTGAGGAAAGCCAGC -3'
Posted On2016-04-15