Incidental Mutation 'R4908:Col6a3'
ID379150
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Namecollagen, type VI, alpha 3
SynonymsCol6a-3
MMRRC Submission 042510-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4908 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location90765923-90843971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90807524 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1408 (L1408P)
Ref Sequence ENSEMBL: ENSMUSP00000115210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]
Predicted Effect probably damaging
Transcript: ENSMUST00000056925
AA Change: L1408P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: L1408P

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097653
AA Change: L801P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: L801P

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130846
AA Change: L1408P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: L1408P

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136916
Predicted Effect probably damaging
Transcript: ENSMUST00000188587
AA Change: L801P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: L801P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,943 I79L probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acaa1a G A 9: 119,348,706 S218N probably benign Het
Acsm5 A T 7: 119,538,091 I377F probably damaging Het
Ahnak2 T C 12: 112,775,272 T789A probably benign Het
Ak9 A T 10: 41,420,682 T1475S unknown Het
AU040320 A T 4: 126,853,288 N1028Y probably damaging Het
Bahcc1 T A 11: 120,287,754 S2380T probably benign Het
Cadps A G 14: 12,536,386 Y525H probably damaging Het
Casp8ap2 A G 4: 32,639,905 T320A possibly damaging Het
Ccdc138 A G 10: 58,544,995 N483D possibly damaging Het
Ccdc39 G A 3: 33,839,093 probably null Het
Cd300c2 T C 11: 114,996,946 N210S probably damaging Het
Cd84 A G 1: 171,872,865 D183G probably damaging Het
Cep95 C T 11: 106,811,346 P390S probably damaging Het
Chd9 A T 8: 91,015,249 H1622L possibly damaging Het
Cilp C A 9: 65,278,020 Q466K probably benign Het
Cinp T A 12: 110,884,053 T5S probably damaging Het
Clec4a2 T C 6: 123,142,503 L238S probably damaging Het
Cntrob T C 11: 69,320,906 Y164C probably damaging Het
Cul3 G A 1: 80,280,915 S468L possibly damaging Het
Dnah11 T A 12: 118,126,883 D1081V probably benign Het
Dnah2 C A 11: 69,521,147 V263L probably benign Het
Efna3 C G 3: 89,315,498 R185P probably damaging Het
F5 A T 1: 164,211,820 I2000F probably damaging Het
Fancm G A 12: 65,094,871 G422E probably benign Het
Gcnt2 A T 13: 40,860,734 D127V probably damaging Het
Gm21798 G T 15: 64,817,769 probably benign Het
Gm340 T A 19: 41,584,162 V452D probably benign Het
Gramd1a A C 7: 31,138,867 S320R probably benign Het
Grn T C 11: 102,436,518 probably benign Het
Helq A T 5: 100,762,641 probably null Het
Herc2 A G 7: 56,177,912 I2914V probably benign Het
Hnrnph1 T C 11: 50,378,410 V27A probably damaging Het
Hs1bp3 G T 12: 8,324,007 G182C probably damaging Het
Idnk C T 13: 58,163,453 P78L probably benign Het
Il10ra T C 9: 45,255,621 D544G probably benign Het
Inpp5e T C 2: 26,400,906 D383G probably damaging Het
Jak1 A T 4: 101,179,714 V243D probably damaging Het
Kcnma1 A T 14: 23,309,152 S1036T probably damaging Het
Kif26a G A 12: 112,157,342 C127Y probably damaging Het
Kif2c T C 4: 117,166,411 E368G probably damaging Het
Lasp1 T A 11: 97,833,704 probably null Het
Lrrtm1 C G 6: 77,244,678 H373D probably benign Het
Matr3 T A 18: 35,572,701 D226E probably damaging Het
Mmp17 G A 5: 129,605,666 W456* probably null Het
Mpp4 T C 1: 59,125,589 E463G probably damaging Het
Myh6 A C 14: 54,956,962 F737V probably damaging Het
Nars2 T A 7: 97,023,741 D271E probably benign Het
Nav2 A G 7: 49,604,510 E2352G probably damaging Het
Nckap1 A G 2: 80,523,374 probably null Het
Nckap5 A T 1: 126,027,587 S477R probably damaging Het
Nek11 T G 9: 105,298,289 I319L probably benign Het
Neto2 A G 8: 85,669,764 I84T probably damaging Het
Nlrp9a A T 7: 26,550,944 I45F probably damaging Het
Numa1 G A 7: 102,012,805 R548H probably damaging Het
Olfr1154 A T 2: 87,903,189 N162K probably damaging Het
Olfr1186 T A 2: 88,525,910 I109N probably damaging Het
Olfr1258 A T 2: 89,930,579 M257L probably benign Het
Olfr1280 T A 2: 111,316,229 F250Y probably benign Het
Olfr292 A C 7: 86,695,187 I244L probably benign Het
Olfr694 A T 7: 106,689,533 L66H probably damaging Het
Olfr713 A C 7: 107,036,157 M1L probably benign Het
Olfr843 A G 9: 19,248,853 V182A probably benign Het
Pcdhb16 T A 18: 37,479,841 probably null Het
Pdcd10 T C 3: 75,541,246 T4A probably damaging Het
Pgc A T 17: 47,728,894 Y71F probably damaging Het
Phlpp1 G A 1: 106,389,751 G1234E probably damaging Het
Prr27 T C 5: 87,843,029 F167L probably benign Het
Prrc2b T A 2: 32,226,318 S1421T possibly damaging Het
Pxmp2 A G 5: 110,283,652 V75A probably benign Het
Pygl A T 12: 70,197,033 M545K probably null Het
Ranbp9 A G 13: 43,421,257 Y412H possibly damaging Het
Rcc1 A G 4: 132,337,753 V140A probably damaging Het
Reln A G 5: 21,979,720 V1599A probably benign Het
Rhebl1 A T 15: 98,879,022 D122E probably damaging Het
Rock2 C T 12: 16,959,491 L676F probably benign Het
Scn9a A T 2: 66,526,743 D1062E probably benign Het
Sec63 T C 10: 42,805,190 I390T probably damaging Het
Slc10a6 T C 5: 103,606,627 E346G probably benign Het
Slc12a3 G A 8: 94,348,588 V737M possibly damaging Het
Slc12a8 T C 16: 33,606,259 probably null Het
Slc25a38 T A 9: 120,120,288 I102N probably damaging Het
Spg7 T A 8: 123,080,655 V390E probably damaging Het
Tbc1d20 T C 2: 152,302,308 V75A probably benign Het
Tesk1 T A 4: 43,445,555 C243* probably null Het
Ttk T A 9: 83,843,686 N220K possibly damaging Het
Ttll5 A G 12: 85,919,174 E651G probably benign Het
Tubd1 T C 11: 86,567,053 Y426H probably damaging Het
Uba6 T C 5: 86,140,434 silent Het
Ube2ql1 G A 13: 69,704,170 R263W probably damaging Het
Vmn2r117 C T 17: 23,459,838 G804D probably damaging Het
Vmn2r25 C T 6: 123,828,447 E484K probably benign Het
Vmn2r4 T A 3: 64,389,055 I770F possibly damaging Het
Vmn2r82 G A 10: 79,378,755 V191M probably benign Het
Zbtb45 C T 7: 13,008,110 V74M probably damaging Het
Zfp366 T C 13: 99,234,101 V443A possibly damaging Het
Zfyve1 A T 12: 83,551,571 C628S probably damaging Het
Zfyve26 A T 12: 79,249,695 probably null Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90828255 missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90782026 missense unknown
IGL00541:Col6a3 APN 1 90802142 missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90802332 missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90803933 missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90807510 missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90802292 missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90802514 missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90779162 missense unknown
IGL01827:Col6a3 APN 1 90802319 missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90796571 missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90773048 missense unknown
IGL01900:Col6a3 APN 1 90795010 critical splice donor site probably null
IGL01925:Col6a3 APN 1 90802236 missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90782136 splice site probably benign
IGL02115:Col6a3 APN 1 90807651 missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90781760 missense unknown
IGL02313:Col6a3 APN 1 90811606 missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90779197 missense unknown
IGL02821:Col6a3 APN 1 90803878 missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90796559 missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90811520 nonsense probably null
IGL03129:Col6a3 APN 1 90821862 missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90803893 missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90827866 missense probably benign 0.33
IGL03251:Col6a3 APN 1 90810176 missense probably damaging 1.00
Noodloid UTSW 1 90779289 missense unknown
stringy UTSW 1 90803678 nonsense probably null
ANU05:Col6a3 UTSW 1 90802292 missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90810248 missense possibly damaging 0.58
PIT4810001:Col6a3 UTSW 1 90778794 missense unknown
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90798161 missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90813551 missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90798173 missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90807704 missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90828049 missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90788216 missense unknown
R0512:Col6a3 UTSW 1 90821798 intron probably benign
R0564:Col6a3 UTSW 1 90807734 missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90808086 splice site probably null
R0667:Col6a3 UTSW 1 90828101 missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90778981 missense unknown
R0736:Col6a3 UTSW 1 90804089 missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90828298 missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90802653 missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90794325 missense probably null 1.00
R1169:Col6a3 UTSW 1 90822014 missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90781855 missense unknown
R1225:Col6a3 UTSW 1 90811516 missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90768347 missense unknown
R1387:Col6a3 UTSW 1 90822416 intron probably benign
R1437:Col6a3 UTSW 1 90801376 missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90781855 missense unknown
R1677:Col6a3 UTSW 1 90821861 missense probably benign 0.14
R1681:Col6a3 UTSW 1 90773502 missense unknown
R1711:Col6a3 UTSW 1 90830213 missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90796574 critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90779059 missense unknown
R1738:Col6a3 UTSW 1 90816361 missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90813794 missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90827949 missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90830214 missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1895:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1908:Col6a3 UTSW 1 90811699 missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90822359 missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90804175 missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90782011 missense unknown
R2121:Col6a3 UTSW 1 90810365 missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90803745 missense probably benign 0.09
R2448:Col6a3 UTSW 1 90813358 missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90803713 missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90775599 missense unknown
R3052:Col6a3 UTSW 1 90802130 missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3419:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3837:Col6a3 UTSW 1 90780081 missense unknown
R4007:Col6a3 UTSW 1 90802569 missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90821883 missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90801383 missense probably benign 0.28
R4244:Col6a3 UTSW 1 90786639 missense unknown
R4297:Col6a3 UTSW 1 90811378 missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90822014 missense probably benign 0.23
R4600:Col6a3 UTSW 1 90781904 missense unknown
R4683:Col6a3 UTSW 1 90773457 missense unknown
R4788:Col6a3 UTSW 1 90772950 critical splice donor site probably null
R4851:Col6a3 UTSW 1 90779289 missense unknown
R4899:Col6a3 UTSW 1 90802427 missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90801442 missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90804218 missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90778843 missense unknown
R5057:Col6a3 UTSW 1 90816130 missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90779352 missense unknown
R5105:Col6a3 UTSW 1 90798140 missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90768345 missense unknown
R5166:Col6a3 UTSW 1 90810608 missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90773639 nonsense probably null
R5196:Col6a3 UTSW 1 90816538 splice site probably null
R5230:Col6a3 UTSW 1 90789054 missense unknown
R5268:Col6a3 UTSW 1 90785243 missense unknown
R5381:Col6a3 UTSW 1 90775612 missense unknown
R5392:Col6a3 UTSW 1 90801295 missense probably benign 0.41
R5445:Col6a3 UTSW 1 90782039 nonsense probably null
R5571:Col6a3 UTSW 1 90788216 missense unknown
R5665:Col6a3 UTSW 1 90827880 missense probably benign 0.00
R5902:Col6a3 UTSW 1 90802199 splice site probably null
R5914:Col6a3 UTSW 1 90776200 missense unknown
R5955:Col6a3 UTSW 1 90811441 missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90821849 missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90768383 missense unknown
R6010:Col6a3 UTSW 1 90773497 missense unknown
R6025:Col6a3 UTSW 1 90828102 missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90813753 missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90773665 missense unknown
R6181:Col6a3 UTSW 1 90816374 missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90822341 missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90822233 missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90810563 missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90781812 missense unknown
R6484:Col6a3 UTSW 1 90791923 critical splice donor site probably null
R6701:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6702:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6724:Col6a3 UTSW 1 90779152 missense unknown
R6746:Col6a3 UTSW 1 90779045 missense unknown
R6797:Col6a3 UTSW 1 90804088 missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90795009 splice site probably null
R6903:Col6a3 UTSW 1 90794207 missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90816002 missense probably benign 0.00
R6978:Col6a3 UTSW 1 90807470 critical splice donor site probably null
R7058:Col6a3 UTSW 1 90828037 nonsense probably null
R7182:Col6a3 UTSW 1 90803678 nonsense probably null
R7294:Col6a3 UTSW 1 90828283 missense probably damaging 1.00
R7296:Col6a3 UTSW 1 90827986 missense probably benign 0.00
R7311:Col6a3 UTSW 1 90822291 missense probably damaging 1.00
R7412:Col6a3 UTSW 1 90828133 missense probably damaging 0.98
R7561:Col6a3 UTSW 1 90775741 missense unknown
R7575:Col6a3 UTSW 1 90810599 missense possibly damaging 0.92
R7659:Col6a3 UTSW 1 90781745 missense unknown
R7679:Col6a3 UTSW 1 90811751 missense possibly damaging 0.49
R7831:Col6a3 UTSW 1 90796546 nonsense probably null
R7855:Col6a3 UTSW 1 90810621 missense possibly damaging 0.57
R7990:Col6a3 UTSW 1 90781855 missense unknown
R8003:Col6a3 UTSW 1 90775733 missense unknown
R8007:Col6a3 UTSW 1 90777457 missense unknown
R8098:Col6a3 UTSW 1 90803661 missense probably benign
R8312:Col6a3 UTSW 1 90813690 missense possibly damaging 0.55
R8419:Col6a3 UTSW 1 90802213 missense probably damaging 1.00
RF005:Col6a3 UTSW 1 90811262 missense probably benign 0.00
RF012:Col6a3 UTSW 1 90810560 missense probably damaging 1.00
X0024:Col6a3 UTSW 1 90803637 critical splice donor site probably null
X0063:Col6a3 UTSW 1 90803905 missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90811529 missense probably damaging 1.00
Z1177:Col6a3 UTSW 1 90811728 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAATAATATGGGGAGATGTGCTCAG -3'
(R):5'- ACTCAGCCGTGGAACTCAAG -3'

Sequencing Primer
(F):5'- GCTCAGCCTACAATATATACTAGTGC -3'
(R):5'- AACTCAAGCAGTTCGGTGTG -3'
Posted On2016-04-15