Mutagenetix > Incidental Mutation

Incidental Mutation 'R4908:Scn9a'

379158

Institutional Source

Beutler Lab

Gene Symbol

Scn9a

Ensembl Gene

ENSMUSG00000075316

Gene Name

sodium channel, voltage-gated, type IX, alpha

Synonyms

PN1

MMRRC Submission

042510-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4908 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66480080-66634962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66526743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1062 (D1062E)

Ref Sequence

ENSEMBL: ENSMUSP00000097641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]

AlphaFold

Q62205

Predicted Effect

probably benign
Transcript: ENSMUST00000100063
AA Change: D1062E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: D1062E

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	403	9.5e-78	PFAM
coiled coil region	404	442	N/A	INTRINSIC
Pfam:DUF3451	465	685	1.3e-62	PFAM
Pfam:Ion_trans	768	957	9.9e-48	PFAM
Pfam:Na_trans_assoc	972	1191	2.9e-72	PFAM
low complexity region	1203	1214	N/A	INTRINSIC
Pfam:Ion_trans	1217	1445	2.8e-55	PFAM
PDB:1BYY\|A	1447	1499	9e-27	PDB
Pfam:Ion_trans	1538	1748	3.4e-52	PFAM
Pfam:PKD_channel	1599	1755	1.1e-7	PFAM
IQ	1877	1899	1.03e-3	SMART
low complexity region	1956	1972	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100064
AA Change: D1071E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: D1071E

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	125	412	2.2e-84	PFAM
low complexity region	433	446	N/A	INTRINSIC
Pfam:Na_trans_cytopl	483	693	7.5e-76	PFAM
Pfam:Ion_trans	742	977	4.1e-57	PFAM
Pfam:Na_trans_assoc	981	1185	1.4e-58	PFAM
Pfam:Ion_trans	1189	1466	7e-67	PFAM
Pfam:Ion_trans	1512	1769	1e-55	PFAM
Pfam:PKD_channel	1605	1763	2.6e-7	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112354
AA Change: D1060E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: D1060E

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.2e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119700

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141149

Predicted Effect

probably benign
Transcript: ENSMUST00000164384
AA Change: D1071E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: D1071E

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.1e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	694	4.2e-66	PFAM
Pfam:Ion_trans	777	966	8.8e-48	PFAM
Pfam:Na_trans_assoc	981	1200	6e-72	PFAM
low complexity region	1212	1223	N/A	INTRINSIC
Pfam:Ion_trans	1226	1454	2.5e-55	PFAM
PDB:1BYY\|A	1456	1508	6e-29	PDB
Pfam:Ion_trans	1547	1757	3e-52	PFAM
Pfam:PKD_channel	1608	1764	8.1e-8	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169900
AA Change: D1060E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: D1060E

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	3.7e-78	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059G10Rik	T	A	9: 122,948,943	I79L	probably benign	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Acaa1a	G	A	9: 119,348,706	S218N	probably benign	Het
Acsm5	A	T	7: 119,538,091	I377F	probably damaging	Het
Ahnak2	T	C	12: 112,775,272	T789A	probably benign	Het
Ak9	A	T	10: 41,420,682	T1475S	unknown	Het
AU040320	A	T	4: 126,853,288	N1028Y	probably damaging	Het
Bahcc1	T	A	11: 120,287,754	S2380T	probably benign	Het
Cadps	A	G	14: 12,536,386	Y525H	probably damaging	Het
Casp8ap2	A	G	4: 32,639,905	T320A	possibly damaging	Het
Ccdc138	A	G	10: 58,544,995	N483D	possibly damaging	Het
Ccdc39	G	A	3: 33,839,093		probably null	Het
Cd300c2	T	C	11: 114,996,946	N210S	probably damaging	Het
Cd84	A	G	1: 171,872,865	D183G	probably damaging	Het
Cep95	C	T	11: 106,811,346	P390S	probably damaging	Het
Chd9	A	T	8: 91,015,249	H1622L	possibly damaging	Het
Cilp	C	A	9: 65,278,020	Q466K	probably benign	Het
Cinp	T	A	12: 110,884,053	T5S	probably damaging	Het
Clec4a2	T	C	6: 123,142,503	L238S	probably damaging	Het
Cntrob	T	C	11: 69,320,906	Y164C	probably damaging	Het
Col6a3	A	G	1: 90,807,524	L1408P	probably damaging	Het
Cul3	G	A	1: 80,280,915	S468L	possibly damaging	Het
Dnah11	T	A	12: 118,126,883	D1081V	probably benign	Het
Dnah2	C	A	11: 69,521,147	V263L	probably benign	Het
Efna3	C	G	3: 89,315,498	R185P	probably damaging	Het
F5	A	T	1: 164,211,820	I2000F	probably damaging	Het
Fancm	G	A	12: 65,094,871	G422E	probably benign	Het
Gcnt2	A	T	13: 40,860,734	D127V	probably damaging	Het
Gm21798	G	T	15: 64,817,769		probably benign	Het
Gm340	T	A	19: 41,584,162	V452D	probably benign	Het
Gramd1a	A	C	7: 31,138,867	S320R	probably benign	Het
Grn	T	C	11: 102,436,518		probably benign	Het
Helq	A	T	5: 100,762,641		probably null	Het
Herc2	A	G	7: 56,177,912	I2914V	probably benign	Het
Hnrnph1	T	C	11: 50,378,410	V27A	probably damaging	Het
Hs1bp3	G	T	12: 8,324,007	G182C	probably damaging	Het
Idnk	C	T	13: 58,163,453	P78L	probably benign	Het
Il10ra	T	C	9: 45,255,621	D544G	probably benign	Het
Inpp5e	T	C	2: 26,400,906	D383G	probably damaging	Het
Jak1	A	T	4: 101,179,714	V243D	probably damaging	Het
Kcnma1	A	T	14: 23,309,152	S1036T	probably damaging	Het
Kif26a	G	A	12: 112,157,342	C127Y	probably damaging	Het
Kif2c	T	C	4: 117,166,411	E368G	probably damaging	Het
Lasp1	T	A	11: 97,833,704		probably null	Het
Lrrtm1	C	G	6: 77,244,678	H373D	probably benign	Het
Matr3	T	A	18: 35,572,701	D226E	probably damaging	Het
Mmp17	G	A	5: 129,605,666	W456*	probably null	Het
Mpp4	T	C	1: 59,125,589	E463G	probably damaging	Het
Myh6	A	C	14: 54,956,962	F737V	probably damaging	Het
Nars2	T	A	7: 97,023,741	D271E	probably benign	Het
Nav2	A	G	7: 49,604,510	E2352G	probably damaging	Het
Nckap1	A	G	2: 80,523,374		probably null	Het
Nckap5	A	T	1: 126,027,587	S477R	probably damaging	Het
Nek11	T	G	9: 105,298,289	I319L	probably benign	Het
Neto2	A	G	8: 85,669,764	I84T	probably damaging	Het
Nlrp9a	A	T	7: 26,550,944	I45F	probably damaging	Het
Numa1	G	A	7: 102,012,805	R548H	probably damaging	Het
Olfr1154	A	T	2: 87,903,189	N162K	probably damaging	Het
Olfr1186	T	A	2: 88,525,910	I109N	probably damaging	Het
Olfr1258	A	T	2: 89,930,579	M257L	probably benign	Het
Olfr1280	T	A	2: 111,316,229	F250Y	probably benign	Het
Olfr292	A	C	7: 86,695,187	I244L	probably benign	Het
Olfr694	A	T	7: 106,689,533	L66H	probably damaging	Het
Olfr713	A	C	7: 107,036,157	M1L	probably benign	Het
Olfr843	A	G	9: 19,248,853	V182A	probably benign	Het
Pcdhb16	T	A	18: 37,479,841		probably null	Het
Pdcd10	T	C	3: 75,541,246	T4A	probably damaging	Het
Pgc	A	T	17: 47,728,894	Y71F	probably damaging	Het
Phlpp1	G	A	1: 106,389,751	G1234E	probably damaging	Het
Prr27	T	C	5: 87,843,029	F167L	probably benign	Het
Prrc2b	T	A	2: 32,226,318	S1421T	possibly damaging	Het
Pxmp2	A	G	5: 110,283,652	V75A	probably benign	Het
Pygl	A	T	12: 70,197,033	M545K	probably null	Het
Ranbp9	A	G	13: 43,421,257	Y412H	possibly damaging	Het
Rcc1	A	G	4: 132,337,753	V140A	probably damaging	Het
Reln	A	G	5: 21,979,720	V1599A	probably benign	Het
Rhebl1	A	T	15: 98,879,022	D122E	probably damaging	Het
Rock2	C	T	12: 16,959,491	L676F	probably benign	Het
Sec63	T	C	10: 42,805,190	I390T	probably damaging	Het
Slc10a6	T	C	5: 103,606,627	E346G	probably benign	Het
Slc12a3	G	A	8: 94,348,588	V737M	possibly damaging	Het
Slc12a8	T	C	16: 33,606,259		probably null	Het
Slc25a38	T	A	9: 120,120,288	I102N	probably damaging	Het
Spg7	T	A	8: 123,080,655	V390E	probably damaging	Het
Tbc1d20	T	C	2: 152,302,308	V75A	probably benign	Het
Tesk1	T	A	4: 43,445,555	C243*	probably null	Het
Ttk	T	A	9: 83,843,686	N220K	possibly damaging	Het
Ttll5	A	G	12: 85,919,174	E651G	probably benign	Het
Tubd1	T	C	11: 86,567,053	Y426H	probably damaging	Het
Uba6	T	C	5: 86,140,434		silent	Het
Ube2ql1	G	A	13: 69,704,170	R263W	probably damaging	Het
Vmn2r117	C	T	17: 23,459,838	G804D	probably damaging	Het
Vmn2r25	C	T	6: 123,828,447	E484K	probably benign	Het
Vmn2r4	T	A	3: 64,389,055	I770F	possibly damaging	Het
Vmn2r82	G	A	10: 79,378,755	V191M	probably benign	Het
Zbtb45	C	T	7: 13,008,110	V74M	probably damaging	Het
Zfp366	T	C	13: 99,234,101	V443A	possibly damaging	Het
Zfyve1	A	T	12: 83,551,571	C628S	probably damaging	Het
Zfyve26	A	T	12: 79,249,695		probably null	Het

Other mutations in Scn9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Scn9a	APN	2	66563601	missense	probably damaging	1.00
IGL00570:Scn9a	APN	2	66484142	missense	probably damaging	1.00
IGL00809:Scn9a	APN	2	66483935	missense	probably damaging	1.00
IGL00977:Scn9a	APN	2	66484301	missense	probably damaging	0.99
IGL01120:Scn9a	APN	2	66526972	missense	probably benign	0.00
IGL01134:Scn9a	APN	2	66504968	missense	probably damaging	1.00
IGL01300:Scn9a	APN	2	66488053	nonsense	probably null
IGL01452:Scn9a	APN	2	66527072	missense	probably damaging	1.00
IGL01531:Scn9a	APN	2	66537378	missense	probably benign	0.11
IGL01572:Scn9a	APN	2	66493886	missense	probably benign	0.00
IGL01645:Scn9a	APN	2	66487642	missense	possibly damaging	0.62
IGL01823:Scn9a	APN	2	66484042	missense	probably damaging	1.00
IGL01965:Scn9a	APN	2	66484433	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66547135	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66494826	missense	probably damaging	1.00
IGL02166:Scn9a	APN	2	66493103	missense	possibly damaging	0.95
IGL02183:Scn9a	APN	2	66484611	splice site	probably benign
IGL02640:Scn9a	APN	2	66536096	critical splice donor site	probably null
IGL02685:Scn9a	APN	2	66537293	missense	probably damaging	1.00
IGL02798:Scn9a	APN	2	66540559	missense	possibly damaging	0.52
IGL02832:Scn9a	APN	2	66568029	missense	probably damaging	1.00
IGL03008:Scn9a	APN	2	66562511	missense	probably damaging	1.00
IGL03270:Scn9a	APN	2	66484014	missense	probably damaging	1.00
IGL03408:Scn9a	APN	2	66526747	missense	probably benign	0.00
BB007:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
BB017:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R0039:Scn9a	UTSW	2	66562444	missense	probably damaging	0.98
R0173:Scn9a	UTSW	2	66533093	missense	probably damaging	1.00
R0323:Scn9a	UTSW	2	66568131	missense	probably damaging	1.00
R0344:Scn9a	UTSW	2	66505010	missense	probably damaging	0.99
R0421:Scn9a	UTSW	2	66543277	missense	probably benign
R0465:Scn9a	UTSW	2	66526996	missense	probably damaging	1.00
R0514:Scn9a	UTSW	2	66483678	missense	probably damaging	1.00
R0599:Scn9a	UTSW	2	66526799	missense	probably damaging	0.96
R0627:Scn9a	UTSW	2	66537377	missense	probably benign	0.00
R0644:Scn9a	UTSW	2	66533061	critical splice donor site	probably null
R0653:Scn9a	UTSW	2	66533377	missense	probably damaging	1.00
R0685:Scn9a	UTSW	2	66483499	missense	probably benign	0.02
R0718:Scn9a	UTSW	2	66547112	missense	probably damaging	1.00
R0827:Scn9a	UTSW	2	66536124	nonsense	probably null
R0890:Scn9a	UTSW	2	66483735	missense	probably damaging	1.00
R1139:Scn9a	UTSW	2	66504997	missense	probably benign	0.02
R1385:Scn9a	UTSW	2	66563542	missense	probably damaging	1.00
R1398:Scn9a	UTSW	2	66484586	missense	probably benign	0.11
R1496:Scn9a	UTSW	2	66526888	missense	probably benign
R1511:Scn9a	UTSW	2	66526813	missense	probably benign	0.01
R1517:Scn9a	UTSW	2	66505027	splice site	probably benign
R1564:Scn9a	UTSW	2	66484304	missense	probably damaging	1.00
R1634:Scn9a	UTSW	2	66488017	missense	probably damaging	1.00
R1662:Scn9a	UTSW	2	66483459	missense	probably benign	0.00
R1695:Scn9a	UTSW	2	66504876	nonsense	probably null
R1709:Scn9a	UTSW	2	66483506	missense	probably damaging	1.00
R1741:Scn9a	UTSW	2	66487594	missense	probably damaging	0.99
R1755:Scn9a	UTSW	2	66501716	missense	probably benign	0.38
R1914:Scn9a	UTSW	2	66566250	missense	probably damaging	1.00
R1962:Scn9a	UTSW	2	66484311	missense	probably damaging	1.00
R1970:Scn9a	UTSW	2	66515380	missense	probably damaging	0.97
R2017:Scn9a	UTSW	2	66515321	missense	probably damaging	0.99
R2092:Scn9a	UTSW	2	66533376	missense	probably damaging	0.99
R2105:Scn9a	UTSW	2	66568183	missense	probably benign	0.25
R2114:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2115:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2128:Scn9a	UTSW	2	66526654	missense	probably damaging	1.00
R2157:Scn9a	UTSW	2	66536325	missense	probably damaging	1.00
R2162:Scn9a	UTSW	2	66534229	missense	probably damaging	0.98
R2350:Scn9a	UTSW	2	66504968	missense	probably damaging	1.00
R3694:Scn9a	UTSW	2	66562405	missense	probably benign
R3771:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3772:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3773:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3922:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R3926:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R4258:Scn9a	UTSW	2	66565054	intron	probably benign
R4385:Scn9a	UTSW	2	66484556	missense	probably damaging	1.00
R4415:Scn9a	UTSW	2	66526693	missense	probably damaging	1.00
R4570:Scn9a	UTSW	2	66483558	missense	possibly damaging	0.85
R4682:Scn9a	UTSW	2	66547018	missense	probably benign
R4783:Scn9a	UTSW	2	66540623	missense	probably benign	0.01
R4822:Scn9a	UTSW	2	66483749	missense	possibly damaging	0.55
R4829:Scn9a	UTSW	2	66551713	missense	probably benign
R4983:Scn9a	UTSW	2	66566270	missense	probably benign	0.02
R5047:Scn9a	UTSW	2	66562480	missense	probably damaging	1.00
R5100:Scn9a	UTSW	2	66534119	missense	probably damaging	1.00
R5140:Scn9a	UTSW	2	66565167	missense	possibly damaging	0.81
R5398:Scn9a	UTSW	2	66488043	missense	probably damaging	1.00
R5557:Scn9a	UTSW	2	66547103	missense	probably damaging	0.99
R5582:Scn9a	UTSW	2	66565029	intron	probably benign
R6108:Scn9a	UTSW	2	66484049	missense	probably damaging	1.00
R6115:Scn9a	UTSW	2	66563629	missense	possibly damaging	0.70
R6143:Scn9a	UTSW	2	66487524	missense	probably benign	0.00
R6261:Scn9a	UTSW	2	66483896	missense	probably damaging	1.00
R6335:Scn9a	UTSW	2	66568264	start codon destroyed	possibly damaging	0.91
R6429:Scn9a	UTSW	2	66526963	missense	possibly damaging	0.95
R6632:Scn9a	UTSW	2	66483502	missense	probably benign	0.23
R6681:Scn9a	UTSW	2	66563342	missense	possibly damaging	0.90
R6830:Scn9a	UTSW	2	66568029	missense	probably damaging	1.00
R7102:Scn9a	UTSW	2	66549015	missense	probably damaging	1.00
R7186:Scn9a	UTSW	2	66534223	missense	probably damaging	1.00
R7243:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R7311:Scn9a	UTSW	2	66484404	missense	possibly damaging	0.54
R7328:Scn9a	UTSW	2	66484587	missense	probably benign
R7386:Scn9a	UTSW	2	66540550	missense	probably damaging	1.00
R7438:Scn9a	UTSW	2	66547187	missense	possibly damaging	0.81
R7483:Scn9a	UTSW	2	66533348	missense	probably damaging	0.99
R7485:Scn9a	UTSW	2	66534217	missense	probably damaging	1.00
R7526:Scn9a	UTSW	2	66483646	missense	probably benign
R7617:Scn9a	UTSW	2	66540549	missense	possibly damaging	0.55
R7642:Scn9a	UTSW	2	66536236	missense	probably benign	0.02
R7653:Scn9a	UTSW	2	66527080	missense	probably damaging	1.00
R7747:Scn9a	UTSW	2	66484298	missense	probably damaging	1.00
R7823:Scn9a	UTSW	2	66483791	missense	probably damaging	1.00
R7864:Scn9a	UTSW	2	66484560	missense	possibly damaging	0.73
R7890:Scn9a	UTSW	2	66543112	missense	probably benign	0.00
R7930:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R7975:Scn9a	UTSW	2	66484253	missense	probably damaging	1.00
R8057:Scn9a	UTSW	2	66515430	missense	probably benign	0.06
R8145:Scn9a	UTSW	2	66487410	missense	probably damaging	1.00
R8163:Scn9a	UTSW	2	66484401	missense	probably damaging	1.00
R8165:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R8342:Scn9a	UTSW	2	66536282	missense	probably benign
R8345:Scn9a	UTSW	2	66494622	missense	probably damaging	0.96
R8464:Scn9a	UTSW	2	66566281	missense	probably damaging	0.99
R8467:Scn9a	UTSW	2	66501671	missense	probably damaging	1.00
R8698:Scn9a	UTSW	2	66536284	missense	probably benign	0.00
R8810:Scn9a	UTSW	2	66501666	missense	probably damaging	1.00
R8822:Scn9a	UTSW	2	66540635	missense	probably damaging	0.99
R8829:Scn9a	UTSW	2	66483617	missense	probably benign
R9009:Scn9a	UTSW	2	66508583	missense	probably damaging	1.00
R9038:Scn9a	UTSW	2	66494803	missense	probably damaging	1.00
R9126:Scn9a	UTSW	2	66484400	missense	probably damaging	1.00
R9205:Scn9a	UTSW	2	66533313	missense	probably damaging	1.00
R9300:Scn9a	UTSW	2	66504892	missense	probably benign	0.39
R9373:Scn9a	UTSW	2	66483917	missense	probably benign	0.00
R9404:Scn9a	UTSW	2	66526696	missense	probably benign	0.02
R9443:Scn9a	UTSW	2	66565209	missense	probably damaging	1.00
R9590:Scn9a	UTSW	2	66483984	missense	probably benign	0.05
R9612:Scn9a	UTSW	2	66533364	missense	probably damaging	1.00
R9617:Scn9a	UTSW	2	66562465	missense	probably damaging	1.00
R9717:Scn9a	UTSW	2	66526658	missense	probably benign
X0003:Scn9a	UTSW	2	66508647	missense	probably benign	0.02
X0062:Scn9a	UTSW	2	66568077	missense	probably damaging	1.00
Z1176:Scn9a	UTSW	2	66540592	missense	probably benign	0.00
Z1177:Scn9a	UTSW	2	66494685	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGGGCAACATTAGACCTGAG -3'
(R):5'- GACCCTGCGTGAATTCATTC -3'

Sequencing Primer
(F):5'- TGGGCAACATTAGACCTGAGATATC -3'
(R):5'- GACCCTGCGTGAATTCATTCTAAAG -3'

Posted On

2016-04-15