Incidental Mutation 'R4908:Acsm5'
ID 379199
Institutional Source Beutler Lab
Gene Symbol Acsm5
Ensembl Gene ENSMUSG00000030972
Gene Name acyl-CoA synthetase medium-chain family member 5
Synonyms C730027J19Rik
MMRRC Submission 042510-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R4908 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 119125354-119142583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119137314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 377 (I377F)
Ref Sequence ENSEMBL: ENSMUSP00000146520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066465] [ENSMUST00000207307] [ENSMUST00000207381] [ENSMUST00000207387] [ENSMUST00000207440] [ENSMUST00000207796] [ENSMUST00000207813]
AlphaFold Q8BGA8
Predicted Effect probably damaging
Transcript: ENSMUST00000066465
AA Change: I377F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063416
Gene: ENSMUSG00000030972
AA Change: I377F

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
Pfam:AMP-binding 65 477 2.9e-78 PFAM
Pfam:AMP-binding_C 485 565 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207307
Predicted Effect silent
Transcript: ENSMUST00000207381
Predicted Effect probably benign
Transcript: ENSMUST00000207387
Predicted Effect probably damaging
Transcript: ENSMUST00000207440
AA Change: I377F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000207796
AA Change: I377F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000207813
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,778,008 (GRCm39) I79L probably benign Het
Ablim2 C T 5: 35,959,766 (GRCm39) R73C possibly damaging Het
Acaa1a G A 9: 119,177,772 (GRCm39) S218N probably benign Het
Ahnak2 T C 12: 112,741,706 (GRCm39) T789A probably benign Het
Ak9 A T 10: 41,296,678 (GRCm39) T1475S unknown Het
AU040320 A T 4: 126,747,081 (GRCm39) N1028Y probably damaging Het
Bahcc1 T A 11: 120,178,580 (GRCm39) S2380T probably benign Het
Cadps A G 14: 12,536,386 (GRCm38) Y525H probably damaging Het
Casp8ap2 A G 4: 32,639,905 (GRCm39) T320A possibly damaging Het
Ccdc138 A G 10: 58,380,817 (GRCm39) N483D possibly damaging Het
Ccdc39 G A 3: 33,893,242 (GRCm39) probably null Het
Cd300c2 T C 11: 114,887,772 (GRCm39) N210S probably damaging Het
Cd84 A G 1: 171,700,432 (GRCm39) D183G probably damaging Het
Cep95 C T 11: 106,702,172 (GRCm39) P390S probably damaging Het
Chd9 A T 8: 91,741,877 (GRCm39) H1622L possibly damaging Het
Cilp C A 9: 65,185,302 (GRCm39) Q466K probably benign Het
Cinp T A 12: 110,850,487 (GRCm39) T5S probably damaging Het
Clec4a2 T C 6: 123,119,462 (GRCm39) L238S probably damaging Het
Cntrob T C 11: 69,211,732 (GRCm39) Y164C probably damaging Het
Col6a3 A G 1: 90,735,246 (GRCm39) L1408P probably damaging Het
Cul3 G A 1: 80,258,632 (GRCm39) S468L possibly damaging Het
Dnah11 T A 12: 118,090,618 (GRCm39) D1081V probably benign Het
Dnah2 C A 11: 69,411,973 (GRCm39) V263L probably benign Het
Efna3 C G 3: 89,222,805 (GRCm39) R185P probably damaging Het
F5 A T 1: 164,039,389 (GRCm39) I2000F probably damaging Het
Fancm G A 12: 65,141,645 (GRCm39) G422E probably benign Het
Gcnt2 A T 13: 41,014,210 (GRCm39) D127V probably damaging Het
Gm21798 G T 15: 64,689,618 (GRCm39) probably benign Het
Gramd1a A C 7: 30,838,292 (GRCm39) S320R probably benign Het
Grn T C 11: 102,327,344 (GRCm39) probably benign Het
Helq A T 5: 100,910,507 (GRCm39) probably null Het
Herc2 A G 7: 55,827,660 (GRCm39) I2914V probably benign Het
Hnrnph1 T C 11: 50,269,237 (GRCm39) V27A probably damaging Het
Hs1bp3 G T 12: 8,374,007 (GRCm39) G182C probably damaging Het
Idnk C T 13: 58,311,267 (GRCm39) P78L probably benign Het
Il10ra T C 9: 45,166,919 (GRCm39) D544G probably benign Het
Inpp5e T C 2: 26,290,918 (GRCm39) D383G probably damaging Het
Jak1 A T 4: 101,036,911 (GRCm39) V243D probably damaging Het
Kcnma1 A T 14: 23,359,220 (GRCm39) S1036T probably damaging Het
Kif26a G A 12: 112,123,776 (GRCm39) C127Y probably damaging Het
Kif2c T C 4: 117,023,608 (GRCm39) E368G probably damaging Het
Lasp1 T A 11: 97,724,530 (GRCm39) probably null Het
Lcor T A 19: 41,572,601 (GRCm39) V452D probably benign Het
Lrrtm1 C G 6: 77,221,661 (GRCm39) H373D probably benign Het
Matr3 T A 18: 35,705,754 (GRCm39) D226E probably damaging Het
Mmp17 G A 5: 129,682,730 (GRCm39) W456* probably null Het
Mpp4 T C 1: 59,164,748 (GRCm39) E463G probably damaging Het
Myh6 A C 14: 55,194,419 (GRCm39) F737V probably damaging Het
Nars2 T A 7: 96,672,948 (GRCm39) D271E probably benign Het
Nav2 A G 7: 49,254,258 (GRCm39) E2352G probably damaging Het
Nckap1 A G 2: 80,353,718 (GRCm39) probably null Het
Nckap5 A T 1: 125,955,324 (GRCm39) S477R probably damaging Het
Nek11 T G 9: 105,175,488 (GRCm39) I319L probably benign Het
Neto2 A G 8: 86,396,393 (GRCm39) I84T probably damaging Het
Nlrp9a A T 7: 26,250,369 (GRCm39) I45F probably damaging Het
Numa1 G A 7: 101,662,012 (GRCm39) R548H probably damaging Het
Or10a5 A C 7: 106,635,364 (GRCm39) M1L probably benign Het
Or14c39 A C 7: 86,344,395 (GRCm39) I244L probably benign Het
Or2ag1b A T 7: 106,288,740 (GRCm39) L66H probably damaging Het
Or4c10 A T 2: 89,760,923 (GRCm39) M257L probably benign Het
Or4c100 T A 2: 88,356,254 (GRCm39) I109N probably damaging Het
Or4k36 T A 2: 111,146,574 (GRCm39) F250Y probably benign Het
Or7g25 A G 9: 19,160,149 (GRCm39) V182A probably benign Het
Or9m1 A T 2: 87,733,533 (GRCm39) N162K probably damaging Het
Pcdhb16 T A 18: 37,612,894 (GRCm39) probably null Het
Pdcd10 T C 3: 75,448,553 (GRCm39) T4A probably damaging Het
Pgc A T 17: 48,039,819 (GRCm39) Y71F probably damaging Het
Phlpp1 G A 1: 106,317,481 (GRCm39) G1234E probably damaging Het
Prr27 T C 5: 87,990,888 (GRCm39) F167L probably benign Het
Prrc2b T A 2: 32,116,330 (GRCm39) S1421T possibly damaging Het
Pxmp2 A G 5: 110,431,518 (GRCm39) V75A probably benign Het
Pygl A T 12: 70,243,807 (GRCm39) M545K probably null Het
Ranbp9 A G 13: 43,574,733 (GRCm39) Y412H possibly damaging Het
Rcc1 A G 4: 132,065,064 (GRCm39) V140A probably damaging Het
Reln A G 5: 22,184,718 (GRCm39) V1599A probably benign Het
Rhebl1 A T 15: 98,776,903 (GRCm39) D122E probably damaging Het
Rock2 C T 12: 17,009,492 (GRCm39) L676F probably benign Het
Scn9a A T 2: 66,357,087 (GRCm39) D1062E probably benign Het
Sec63 T C 10: 42,681,186 (GRCm39) I390T probably damaging Het
Slc10a6 T C 5: 103,754,493 (GRCm39) E346G probably benign Het
Slc12a3 G A 8: 95,075,216 (GRCm39) V737M possibly damaging Het
Slc12a8 T C 16: 33,426,629 (GRCm39) probably null Het
Slc25a38 T A 9: 119,949,354 (GRCm39) I102N probably damaging Het
Spg7 T A 8: 123,807,394 (GRCm39) V390E probably damaging Het
Tbc1d20 T C 2: 152,144,228 (GRCm39) V75A probably benign Het
Tesk1 T A 4: 43,445,555 (GRCm39) C243* probably null Het
Ttk T A 9: 83,725,739 (GRCm39) N220K possibly damaging Het
Ttll5 A G 12: 85,965,948 (GRCm39) E651G probably benign Het
Tubd1 T C 11: 86,457,879 (GRCm39) Y426H probably damaging Het
Uba6 T C 5: 86,288,293 (GRCm39) silent Het
Ube2ql1 G A 13: 69,852,289 (GRCm39) R263W probably damaging Het
Vmn2r117 C T 17: 23,678,812 (GRCm39) G804D probably damaging Het
Vmn2r25 C T 6: 123,805,406 (GRCm39) E484K probably benign Het
Vmn2r4 T A 3: 64,296,476 (GRCm39) I770F possibly damaging Het
Vmn2r82 G A 10: 79,214,589 (GRCm39) V191M probably benign Het
Zbtb45 C T 7: 12,742,037 (GRCm39) V74M probably damaging Het
Zfp366 T C 13: 99,370,609 (GRCm39) V443A possibly damaging Het
Zfyve1 A T 12: 83,598,345 (GRCm39) C628S probably damaging Het
Zfyve26 A T 12: 79,296,469 (GRCm39) probably null Het
Other mutations in Acsm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Acsm5 APN 7 119,141,661 (GRCm39) critical splice donor site probably null
IGL01662:Acsm5 APN 7 119,137,511 (GRCm39) missense probably damaging 1.00
IGL02228:Acsm5 APN 7 119,131,089 (GRCm39) missense probably damaging 1.00
IGL02380:Acsm5 APN 7 119,136,509 (GRCm39) missense probably benign 0.05
IGL02709:Acsm5 APN 7 119,134,041 (GRCm39) nonsense probably null
P4717OSA:Acsm5 UTSW 7 119,131,195 (GRCm39) missense probably benign 0.12
R0506:Acsm5 UTSW 7 119,137,319 (GRCm39) nonsense probably null
R0518:Acsm5 UTSW 7 119,135,023 (GRCm39) missense possibly damaging 0.95
R0866:Acsm5 UTSW 7 119,140,123 (GRCm39) missense probably damaging 0.99
R1171:Acsm5 UTSW 7 119,140,075 (GRCm39) missense probably damaging 0.99
R2362:Acsm5 UTSW 7 119,127,649 (GRCm39) start gained probably benign
R2511:Acsm5 UTSW 7 119,129,677 (GRCm39) missense possibly damaging 0.80
R4670:Acsm5 UTSW 7 119,130,983 (GRCm39) splice site probably null
R4913:Acsm5 UTSW 7 119,133,566 (GRCm39) missense probably damaging 0.98
R5038:Acsm5 UTSW 7 119,134,034 (GRCm39) missense probably damaging 1.00
R5112:Acsm5 UTSW 7 119,136,502 (GRCm39) missense possibly damaging 0.95
R6337:Acsm5 UTSW 7 119,133,458 (GRCm39) missense probably benign 0.00
R6481:Acsm5 UTSW 7 119,134,104 (GRCm39) missense probably benign 0.02
R7268:Acsm5 UTSW 7 119,136,511 (GRCm39) missense probably benign 0.38
R7275:Acsm5 UTSW 7 119,136,511 (GRCm39) missense possibly damaging 0.81
R7509:Acsm5 UTSW 7 119,133,611 (GRCm39) missense probably benign
R7794:Acsm5 UTSW 7 119,137,352 (GRCm39) unclassified probably benign
R8021:Acsm5 UTSW 7 119,141,616 (GRCm39) missense possibly damaging 0.72
R8178:Acsm5 UTSW 7 119,141,618 (GRCm39) missense probably damaging 1.00
R8797:Acsm5 UTSW 7 119,137,374 (GRCm39) missense probably damaging 1.00
Z1088:Acsm5 UTSW 7 119,136,434 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGTCTCCATCCGTGAAAAGC -3'
(R):5'- CTGAGCATCCTTTACACAGTGAC -3'

Sequencing Primer
(F):5'- GTCTCCATCCGTGAAAAGCATGAG -3'
(R):5'- GCATCCTTTACACAGTGACGGTAC -3'
Posted On 2016-04-15