Incidental Mutation 'R4908:Grn'
ID379220
Institutional Source Beutler Lab
Gene Symbol Grn
Ensembl Gene ENSMUSG00000034708
Gene Namegranulin
Synonymsprogranulin, epithelin, acrogranulin, PC cell-derived growth factor, Pgrn
MMRRC Submission 042510-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R4908 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102430315-102437048 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 102436518 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057] [ENSMUST00000049460] [ENSMUST00000125819] [ENSMUST00000129997]
Predicted Effect probably benign
Transcript: ENSMUST00000049057
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049460
SMART Domains Protein: ENSMUSP00000046340
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
GRAN 74 125 1.32e-22 SMART
GRAN 138 190 7.38e-26 SMART
GRAN 220 272 5.76e-28 SMART
GRAN 295 346 1.19e-29 SMART
GRAN 377 427 1.84e-26 SMART
GRAN 455 506 7.1e-28 SMART
GRAN 530 581 1.48e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123500
Predicted Effect probably benign
Transcript: ENSMUST00000125819
SMART Domains Protein: ENSMUSP00000134948
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 42 72 5.03e-4 SMART
GRAN 100 151 7.1e-28 SMART
GRAN 175 226 1.48e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127530
Predicted Effect probably benign
Transcript: ENSMUST00000129997
SMART Domains Protein: ENSMUSP00000135739
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GRAN 61 112 1.32e-22 SMART
GRAN 125 177 7.38e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176953
Predicted Effect unknown
Transcript: ENSMUST00000177428
AA Change: V235A
SMART Domains Protein: ENSMUSP00000134893
Gene: ENSMUSG00000034708
AA Change: V235A

DomainStartEndE-ValueType
GRAN 1 49 8.68e-23 SMART
GRAN 77 128 7.1e-28 SMART
GRAN 152 180 3.98e-2 SMART
low complexity region 244 259 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some knock-out alleles display enhanced macrophage functions. Mice homozygous for another knock-out allele display reproductive and behavioral abnormalities. Mice homozygous for a third null allele display premature death and increased cellular aging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,943 I79L probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acaa1a G A 9: 119,348,706 S218N probably benign Het
Acsm5 A T 7: 119,538,091 I377F probably damaging Het
Ahnak2 T C 12: 112,775,272 T789A probably benign Het
Ak9 A T 10: 41,420,682 T1475S unknown Het
AU040320 A T 4: 126,853,288 N1028Y probably damaging Het
Bahcc1 T A 11: 120,287,754 S2380T probably benign Het
Cadps A G 14: 12,536,386 Y525H probably damaging Het
Casp8ap2 A G 4: 32,639,905 T320A possibly damaging Het
Ccdc138 A G 10: 58,544,995 N483D possibly damaging Het
Ccdc39 G A 3: 33,839,093 probably null Het
Cd300c2 T C 11: 114,996,946 N210S probably damaging Het
Cd84 A G 1: 171,872,865 D183G probably damaging Het
Cep95 C T 11: 106,811,346 P390S probably damaging Het
Chd9 A T 8: 91,015,249 H1622L possibly damaging Het
Cilp C A 9: 65,278,020 Q466K probably benign Het
Cinp T A 12: 110,884,053 T5S probably damaging Het
Clec4a2 T C 6: 123,142,503 L238S probably damaging Het
Cntrob T C 11: 69,320,906 Y164C probably damaging Het
Col6a3 A G 1: 90,807,524 L1408P probably damaging Het
Cul3 G A 1: 80,280,915 S468L possibly damaging Het
Dnah11 T A 12: 118,126,883 D1081V probably benign Het
Dnah2 C A 11: 69,521,147 V263L probably benign Het
Efna3 C G 3: 89,315,498 R185P probably damaging Het
F5 A T 1: 164,211,820 I2000F probably damaging Het
Fancm G A 12: 65,094,871 G422E probably benign Het
Gcnt2 A T 13: 40,860,734 D127V probably damaging Het
Gm21798 G T 15: 64,817,769 probably benign Het
Gm340 T A 19: 41,584,162 V452D probably benign Het
Gramd1a A C 7: 31,138,867 S320R probably benign Het
Helq A T 5: 100,762,641 probably null Het
Herc2 A G 7: 56,177,912 I2914V probably benign Het
Hnrnph1 T C 11: 50,378,410 V27A probably damaging Het
Hs1bp3 G T 12: 8,324,007 G182C probably damaging Het
Idnk C T 13: 58,163,453 P78L probably benign Het
Il10ra T C 9: 45,255,621 D544G probably benign Het
Inpp5e T C 2: 26,400,906 D383G probably damaging Het
Jak1 A T 4: 101,179,714 V243D probably damaging Het
Kcnma1 A T 14: 23,309,152 S1036T probably damaging Het
Kif26a G A 12: 112,157,342 C127Y probably damaging Het
Kif2c T C 4: 117,166,411 E368G probably damaging Het
Lasp1 T A 11: 97,833,704 probably null Het
Lrrtm1 C G 6: 77,244,678 H373D probably benign Het
Matr3 T A 18: 35,572,701 D226E probably damaging Het
Mmp17 G A 5: 129,605,666 W456* probably null Het
Mpp4 T C 1: 59,125,589 E463G probably damaging Het
Myh6 A C 14: 54,956,962 F737V probably damaging Het
Nars2 T A 7: 97,023,741 D271E probably benign Het
Nav2 A G 7: 49,604,510 E2352G probably damaging Het
Nckap1 A G 2: 80,523,374 probably null Het
Nckap5 A T 1: 126,027,587 S477R probably damaging Het
Nek11 T G 9: 105,298,289 I319L probably benign Het
Neto2 A G 8: 85,669,764 I84T probably damaging Het
Nlrp9a A T 7: 26,550,944 I45F probably damaging Het
Numa1 G A 7: 102,012,805 R548H probably damaging Het
Olfr1154 A T 2: 87,903,189 N162K probably damaging Het
Olfr1186 T A 2: 88,525,910 I109N probably damaging Het
Olfr1258 A T 2: 89,930,579 M257L probably benign Het
Olfr1280 T A 2: 111,316,229 F250Y probably benign Het
Olfr292 A C 7: 86,695,187 I244L probably benign Het
Olfr694 A T 7: 106,689,533 L66H probably damaging Het
Olfr713 A C 7: 107,036,157 M1L probably benign Het
Olfr843 A G 9: 19,248,853 V182A probably benign Het
Pcdhb16 T A 18: 37,479,841 probably null Het
Pdcd10 T C 3: 75,541,246 T4A probably damaging Het
Pgc A T 17: 47,728,894 Y71F probably damaging Het
Phlpp1 G A 1: 106,389,751 G1234E probably damaging Het
Prr27 T C 5: 87,843,029 F167L probably benign Het
Prrc2b T A 2: 32,226,318 S1421T possibly damaging Het
Pxmp2 A G 5: 110,283,652 V75A probably benign Het
Pygl A T 12: 70,197,033 M545K probably null Het
Ranbp9 A G 13: 43,421,257 Y412H possibly damaging Het
Rcc1 A G 4: 132,337,753 V140A probably damaging Het
Reln A G 5: 21,979,720 V1599A probably benign Het
Rhebl1 A T 15: 98,879,022 D122E probably damaging Het
Rock2 C T 12: 16,959,491 L676F probably benign Het
Scn9a A T 2: 66,526,743 D1062E probably benign Het
Sec63 T C 10: 42,805,190 I390T probably damaging Het
Slc10a6 T C 5: 103,606,627 E346G probably benign Het
Slc12a3 G A 8: 94,348,588 V737M possibly damaging Het
Slc12a8 T C 16: 33,606,259 probably null Het
Slc25a38 T A 9: 120,120,288 I102N probably damaging Het
Spg7 T A 8: 123,080,655 V390E probably damaging Het
Tbc1d20 T C 2: 152,302,308 V75A probably benign Het
Tesk1 T A 4: 43,445,555 C243* probably null Het
Ttk T A 9: 83,843,686 N220K possibly damaging Het
Ttll5 A G 12: 85,919,174 E651G probably benign Het
Tubd1 T C 11: 86,567,053 Y426H probably damaging Het
Uba6 T C 5: 86,140,434 silent Het
Ube2ql1 G A 13: 69,704,170 R263W probably damaging Het
Vmn2r117 C T 17: 23,459,838 G804D probably damaging Het
Vmn2r25 C T 6: 123,828,447 E484K probably benign Het
Vmn2r4 T A 3: 64,389,055 I770F possibly damaging Het
Vmn2r82 G A 10: 79,378,755 V191M probably benign Het
Zbtb45 C T 7: 13,008,110 V74M probably damaging Het
Zfp366 T C 13: 99,234,101 V443A possibly damaging Het
Zfyve1 A T 12: 83,551,571 C628S probably damaging Het
Zfyve26 A T 12: 79,249,695 probably null Het
Other mutations in Grn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Grn APN 11 102436258 splice site probably benign
IGL02456:Grn APN 11 102436104 missense probably benign 0.01
PIT4434001:Grn UTSW 11 102435940 missense possibly damaging 0.88
R0395:Grn UTSW 11 102436223 missense probably benign 0.03
R0784:Grn UTSW 11 102434502 missense possibly damaging 0.74
R1037:Grn UTSW 11 102433070 missense possibly damaging 0.94
R1753:Grn UTSW 11 102433267 missense probably damaging 1.00
R1905:Grn UTSW 11 102436450 missense probably damaging 1.00
R3110:Grn UTSW 11 102433243 missense probably benign 0.07
R3111:Grn UTSW 11 102433243 missense probably benign 0.07
R3112:Grn UTSW 11 102433243 missense probably benign 0.07
R3974:Grn UTSW 11 102436339 missense probably damaging 1.00
R4989:Grn UTSW 11 102430554 unclassified probably benign
R5012:Grn UTSW 11 102430554 unclassified probably benign
R5013:Grn UTSW 11 102430554 unclassified probably benign
R5108:Grn UTSW 11 102434402 missense probably benign 0.10
R5133:Grn UTSW 11 102430554 unclassified probably benign
R5134:Grn UTSW 11 102430554 unclassified probably benign
R5162:Grn UTSW 11 102430554 unclassified probably benign
R5182:Grn UTSW 11 102430554 unclassified probably benign
R5183:Grn UTSW 11 102430554 unclassified probably benign
R5308:Grn UTSW 11 102436192 missense possibly damaging 0.96
R5350:Grn UTSW 11 102436244 missense possibly damaging 0.50
R5786:Grn UTSW 11 102434043 nonsense probably null
R6383:Grn UTSW 11 102436795 unclassified probably benign
R7679:Grn UTSW 11 102433069 missense probably benign 0.01
R7741:Grn UTSW 11 102435734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGTCCCTACCTAAAGG -3'
(R):5'- CCGGAAGAAATGGCAGTTTG -3'

Sequencing Primer
(F):5'- GTCAGTGTGACCCTGACTCTG -3'
(R):5'- AATGGCAGTTTGATACGGGGC -3'
Posted On2016-04-15