Incidental Mutation 'R4908:Slc12a8'
ID379244
Institutional Source Beutler Lab
Gene Symbol Slc12a8
Ensembl Gene ENSMUSG00000035506
Gene Namesolute carrier family 12 (potassium/chloride transporters), member 8
Synonyms
MMRRC Submission 042510-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4908 (G1)
Quality Score223
Status Not validated
Chromosome16
Chromosomal Location33517328-33664135 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 33606259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059056] [ENSMUST00000117134] [ENSMUST00000119173] [ENSMUST00000121925] [ENSMUST00000122314] [ENSMUST00000122427]
Predicted Effect probably null
Transcript: ENSMUST00000059056
SMART Domains Protein: ENSMUSP00000062337
Gene: ENSMUSG00000035506

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 410 4e-24 PFAM
Pfam:AA_permease 43 409 5.3e-51 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117134
SMART Domains Protein: ENSMUSP00000112925
Gene: ENSMUSG00000035506

DomainStartEndE-ValueType
Pfam:AA_permease 1 163 3.5e-22 PFAM
low complexity region 235 250 N/A INTRINSIC
transmembrane domain 339 361 N/A INTRINSIC
transmembrane domain 366 388 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119173
SMART Domains Protein: ENSMUSP00000113633
Gene: ENSMUSG00000035506

DomainStartEndE-ValueType
Pfam:AA_permease_2 7 266 4.2e-15 PFAM
Pfam:AA_permease 12 267 1.9e-37 PFAM
transmembrane domain 295 317 N/A INTRINSIC
low complexity region 401 416 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 532 554 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121925
SMART Domains Protein: ENSMUSP00000112439
Gene: ENSMUSG00000035506

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 409 2.4e-23 PFAM
Pfam:AA_permease 43 409 5e-50 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122314
SMART Domains Protein: ENSMUSP00000113901
Gene: ENSMUSG00000035506

DomainStartEndE-ValueType
Pfam:AA_permease 1 163 3.3e-22 PFAM
low complexity region 235 250 N/A INTRINSIC
transmembrane domain 339 361 N/A INTRINSIC
transmembrane domain 366 388 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122427
SMART Domains Protein: ENSMUSP00000113164
Gene: ENSMUSG00000035506

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 386 7.7e-18 PFAM
Pfam:AA_permease 43 381 1.3e-44 PFAM
low complexity region 455 470 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be a candidate for psoriasis susceptibility. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,943 I79L probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acaa1a G A 9: 119,348,706 S218N probably benign Het
Acsm5 A T 7: 119,538,091 I377F probably damaging Het
Ahnak2 T C 12: 112,775,272 T789A probably benign Het
Ak9 A T 10: 41,420,682 T1475S unknown Het
AU040320 A T 4: 126,853,288 N1028Y probably damaging Het
Bahcc1 T A 11: 120,287,754 S2380T probably benign Het
Cadps A G 14: 12,536,386 Y525H probably damaging Het
Casp8ap2 A G 4: 32,639,905 T320A possibly damaging Het
Ccdc138 A G 10: 58,544,995 N483D possibly damaging Het
Ccdc39 G A 3: 33,839,093 probably null Het
Cd300c2 T C 11: 114,996,946 N210S probably damaging Het
Cd84 A G 1: 171,872,865 D183G probably damaging Het
Cep95 C T 11: 106,811,346 P390S probably damaging Het
Chd9 A T 8: 91,015,249 H1622L possibly damaging Het
Cilp C A 9: 65,278,020 Q466K probably benign Het
Cinp T A 12: 110,884,053 T5S probably damaging Het
Clec4a2 T C 6: 123,142,503 L238S probably damaging Het
Cntrob T C 11: 69,320,906 Y164C probably damaging Het
Col6a3 A G 1: 90,807,524 L1408P probably damaging Het
Cul3 G A 1: 80,280,915 S468L possibly damaging Het
Dnah11 T A 12: 118,126,883 D1081V probably benign Het
Dnah2 C A 11: 69,521,147 V263L probably benign Het
Efna3 C G 3: 89,315,498 R185P probably damaging Het
F5 A T 1: 164,211,820 I2000F probably damaging Het
Fancm G A 12: 65,094,871 G422E probably benign Het
Gcnt2 A T 13: 40,860,734 D127V probably damaging Het
Gm21798 G T 15: 64,817,769 probably benign Het
Gm340 T A 19: 41,584,162 V452D probably benign Het
Gramd1a A C 7: 31,138,867 S320R probably benign Het
Grn T C 11: 102,436,518 probably benign Het
Helq A T 5: 100,762,641 probably null Het
Herc2 A G 7: 56,177,912 I2914V probably benign Het
Hnrnph1 T C 11: 50,378,410 V27A probably damaging Het
Hs1bp3 G T 12: 8,324,007 G182C probably damaging Het
Idnk C T 13: 58,163,453 P78L probably benign Het
Il10ra T C 9: 45,255,621 D544G probably benign Het
Inpp5e T C 2: 26,400,906 D383G probably damaging Het
Jak1 A T 4: 101,179,714 V243D probably damaging Het
Kcnma1 A T 14: 23,309,152 S1036T probably damaging Het
Kif26a G A 12: 112,157,342 C127Y probably damaging Het
Kif2c T C 4: 117,166,411 E368G probably damaging Het
Lasp1 T A 11: 97,833,704 probably null Het
Lrrtm1 C G 6: 77,244,678 H373D probably benign Het
Matr3 T A 18: 35,572,701 D226E probably damaging Het
Mmp17 G A 5: 129,605,666 W456* probably null Het
Mpp4 T C 1: 59,125,589 E463G probably damaging Het
Myh6 A C 14: 54,956,962 F737V probably damaging Het
Nars2 T A 7: 97,023,741 D271E probably benign Het
Nav2 A G 7: 49,604,510 E2352G probably damaging Het
Nckap1 A G 2: 80,523,374 probably null Het
Nckap5 A T 1: 126,027,587 S477R probably damaging Het
Nek11 T G 9: 105,298,289 I319L probably benign Het
Neto2 A G 8: 85,669,764 I84T probably damaging Het
Nlrp9a A T 7: 26,550,944 I45F probably damaging Het
Numa1 G A 7: 102,012,805 R548H probably damaging Het
Olfr1154 A T 2: 87,903,189 N162K probably damaging Het
Olfr1186 T A 2: 88,525,910 I109N probably damaging Het
Olfr1258 A T 2: 89,930,579 M257L probably benign Het
Olfr1280 T A 2: 111,316,229 F250Y probably benign Het
Olfr292 A C 7: 86,695,187 I244L probably benign Het
Olfr694 A T 7: 106,689,533 L66H probably damaging Het
Olfr713 A C 7: 107,036,157 M1L probably benign Het
Olfr843 A G 9: 19,248,853 V182A probably benign Het
Pcdhb16 T A 18: 37,479,841 probably null Het
Pdcd10 T C 3: 75,541,246 T4A probably damaging Het
Pgc A T 17: 47,728,894 Y71F probably damaging Het
Phlpp1 G A 1: 106,389,751 G1234E probably damaging Het
Prr27 T C 5: 87,843,029 F167L probably benign Het
Prrc2b T A 2: 32,226,318 S1421T possibly damaging Het
Pxmp2 A G 5: 110,283,652 V75A probably benign Het
Pygl A T 12: 70,197,033 M545K probably null Het
Ranbp9 A G 13: 43,421,257 Y412H possibly damaging Het
Rcc1 A G 4: 132,337,753 V140A probably damaging Het
Reln A G 5: 21,979,720 V1599A probably benign Het
Rhebl1 A T 15: 98,879,022 D122E probably damaging Het
Rock2 C T 12: 16,959,491 L676F probably benign Het
Scn9a A T 2: 66,526,743 D1062E probably benign Het
Sec63 T C 10: 42,805,190 I390T probably damaging Het
Slc10a6 T C 5: 103,606,627 E346G probably benign Het
Slc12a3 G A 8: 94,348,588 V737M possibly damaging Het
Slc25a38 T A 9: 120,120,288 I102N probably damaging Het
Spg7 T A 8: 123,080,655 V390E probably damaging Het
Tbc1d20 T C 2: 152,302,308 V75A probably benign Het
Tesk1 T A 4: 43,445,555 C243* probably null Het
Ttk T A 9: 83,843,686 N220K possibly damaging Het
Ttll5 A G 12: 85,919,174 E651G probably benign Het
Tubd1 T C 11: 86,567,053 Y426H probably damaging Het
Uba6 T C 5: 86,140,434 silent Het
Ube2ql1 G A 13: 69,704,170 R263W probably damaging Het
Vmn2r117 C T 17: 23,459,838 G804D probably damaging Het
Vmn2r25 C T 6: 123,828,447 E484K probably benign Het
Vmn2r4 T A 3: 64,389,055 I770F possibly damaging Het
Vmn2r82 G A 10: 79,378,755 V191M probably benign Het
Zbtb45 C T 7: 13,008,110 V74M probably damaging Het
Zfp366 T C 13: 99,234,101 V443A possibly damaging Het
Zfyve1 A T 12: 83,551,571 C628S probably damaging Het
Zfyve26 A T 12: 79,249,695 probably null Het
Other mutations in Slc12a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Slc12a8 APN 16 33540897 missense probably damaging 1.00
IGL01701:Slc12a8 APN 16 33540910 missense probably damaging 1.00
IGL02024:Slc12a8 APN 16 33608198 missense probably damaging 1.00
IGL02223:Slc12a8 APN 16 33624690 missense probably damaging 1.00
IGL02637:Slc12a8 APN 16 33534960 missense probably benign 0.05
IGL03248:Slc12a8 APN 16 33551027 missense probably damaging 1.00
R0136:Slc12a8 UTSW 16 33608213 missense probably damaging 1.00
R0436:Slc12a8 UTSW 16 33551085 missense probably damaging 1.00
R0586:Slc12a8 UTSW 16 33658230 missense possibly damaging 0.87
R0669:Slc12a8 UTSW 16 33550904 missense possibly damaging 0.91
R0780:Slc12a8 UTSW 16 33646665 splice site probably null
R1170:Slc12a8 UTSW 16 33662977 missense probably damaging 1.00
R1383:Slc12a8 UTSW 16 33534987 missense probably damaging 1.00
R1707:Slc12a8 UTSW 16 33551007 missense probably damaging 1.00
R2917:Slc12a8 UTSW 16 33550926 missense probably damaging 1.00
R4092:Slc12a8 UTSW 16 33617121 missense probably damaging 1.00
R4532:Slc12a8 UTSW 16 33551033 missense probably damaging 1.00
R4604:Slc12a8 UTSW 16 33608159 missense probably damaging 1.00
R4638:Slc12a8 UTSW 16 33590323 missense possibly damaging 0.95
R5148:Slc12a8 UTSW 16 33624918 missense probably benign 0.00
R5186:Slc12a8 UTSW 16 33617208 missense probably damaging 1.00
R5711:Slc12a8 UTSW 16 33590309 missense probably damaging 1.00
R5760:Slc12a8 UTSW 16 33624785 nonsense probably null
R6122:Slc12a8 UTSW 16 33625014 missense probably damaging 0.99
R6592:Slc12a8 UTSW 16 33617256 critical splice donor site probably null
R6995:Slc12a8 UTSW 16 33534893 nonsense probably null
R7602:Slc12a8 UTSW 16 33625124 missense probably benign 0.00
R7772:Slc12a8 UTSW 16 33550965 missense probably damaging 1.00
R7849:Slc12a8 UTSW 16 33624560 missense probably damaging 1.00
R8022:Slc12a8 UTSW 16 33625086 missense probably benign 0.01
R8293:Slc12a8 UTSW 16 33540978 missense probably benign 0.07
R8345:Slc12a8 UTSW 16 33550951 missense probably benign 0.02
Z1176:Slc12a8 UTSW 16 33540965 frame shift probably null
Z1176:Slc12a8 UTSW 16 33606173 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACAGCTTCTAGGAAAGAGCC -3'
(R):5'- TTCTCAGGCAGGACTGTGAAAG -3'

Sequencing Primer
(F):5'- CTTCTAGGAAAGAGCCTGGAG -3'
(R):5'- ACTGTGAAAGGGCAGCATC -3'
Posted On2016-04-15