Incidental Mutation 'R4909:Itga11'
ID379301
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission 042511-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4909 (G1)
Quality Score123
Status Validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62755299 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 518 (Y518C)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably damaging
Transcript: ENSMUST00000034774
AA Change: Y518C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: Y518C

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159012
Meta Mutation Damage Score 0.6140 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik A T 12: 20,815,088 noncoding transcript Het
A830010M20Rik C T 5: 107,507,310 Q992* probably null Het
Aars G A 8: 111,055,083 G929D probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Actn4 A T 7: 28,898,657 L506Q probably damaging Het
Adam26a A T 8: 43,570,438 F5Y probably benign Het
Adamts5 G A 16: 85,900,066 Q68* probably null Het
Adcy9 A G 16: 4,298,754 I871T probably benign Het
Ak5 A T 3: 152,655,877 L136H probably damaging Het
Ap1g2 A G 14: 55,105,026 probably null Het
Ap2a1 G A 7: 44,906,381 T355M probably damaging Het
Ap3s2 T C 7: 79,915,241 D60G possibly damaging Het
Apold1 G A 6: 134,983,595 R4Q probably benign Het
Atp13a5 G T 16: 29,334,028 Q207K possibly damaging Het
BC035947 A C 1: 78,498,029 I622S probably damaging Het
Bmper G T 9: 23,377,725 V339F probably benign Het
C1ra A G 6: 124,522,334 D493G probably damaging Het
C3 C T 17: 57,226,830 probably null Het
Cabp4 T A 19: 4,137,121 I209F possibly damaging Het
Cacna1s A T 1: 136,079,604 H453L probably damaging Het
Camk2g A G 14: 20,792,584 V32A probably benign Het
Ccdc175 G A 12: 72,159,753 R240C probably damaging Het
Cdk13 C T 13: 17,772,403 S590N possibly damaging Het
Cfap45 A T 1: 172,529,876 T24S probably benign Het
Clca1 T G 3: 145,024,563 K174Q probably damaging Het
Col1a2 G A 6: 4,529,058 probably benign Het
Colgalt1 A T 8: 71,620,633 I323F possibly damaging Het
Cpeb3 T C 19: 37,174,233 S248G possibly damaging Het
Cpeb3 A T 19: 37,174,659 S106T probably damaging Het
Ctcfl C T 2: 173,095,398 A576T probably benign Het
Cyp4f16 T G 17: 32,550,321 V395G possibly damaging Het
Dchs1 C T 7: 105,766,255 G605S probably damaging Het
Egflam A T 15: 7,219,629 F903I probably damaging Het
Eif5a G A 11: 69,917,485 A62V possibly damaging Het
Fam217a A G 13: 34,910,406 S609P probably damaging Het
Fhad1 T A 4: 141,985,511 I206F probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fras1 T A 5: 96,708,758 M2000K probably benign Het
Frmd5 C T 2: 121,591,653 probably null Het
Gle1 T C 2: 29,936,080 L57P probably benign Het
Glrx3 C A 7: 137,445,036 N52K probably damaging Het
Grin3b A G 10: 79,977,104 *1004W probably null Het
Hectd4 T A 5: 121,263,891 F347L probably benign Het
Htra1 G A 7: 130,985,072 V462I probably benign Het
Krtap15 T C 16: 88,829,365 F88L probably benign Het
Ktn1 A T 14: 47,706,460 R866W probably damaging Het
Lamb1 G A 12: 31,288,281 R483H probably damaging Het
Megf6 C T 4: 154,265,391 R983C probably damaging Het
Mybpc3 T A 2: 91,134,812 D1075E probably benign Het
Myo7b A T 18: 31,964,436 N1792K probably benign Het
Nabp2 A T 10: 128,401,687 probably benign Het
Neil3 A G 8: 53,638,893 C7R probably damaging Het
Nxpe2 T A 9: 48,319,597 I491F possibly damaging Het
Obscn A G 11: 59,061,465 V4292A possibly damaging Het
Ogfod3 A G 11: 121,197,492 S139P probably damaging Het
Olfr374 A G 8: 72,109,581 N5S probably damaging Het
Olfr418 A T 1: 173,270,979 D268V probably damaging Het
Olfr682-ps1 C A 7: 105,128,228 V70L probably benign Het
Olfr800 A G 10: 129,660,720 I305V probably benign Het
Oog2 T C 4: 144,195,099 I211T possibly damaging Het
Oosp1 T C 19: 11,688,716 D70G probably benign Het
Padi3 T C 4: 140,795,626 D345G probably damaging Het
Pcyt2 A G 11: 120,615,420 F71L probably benign Het
Pi4k2b T C 5: 52,754,629 probably benign Het
Pigr A C 1: 130,848,458 T577P possibly damaging Het
Pirb G A 7: 3,719,362 Q161* probably null Het
Pnlip A G 19: 58,676,240 E204G possibly damaging Het
Pop7 G T 5: 137,501,899 D57E probably benign Het
Ppfia4 A T 1: 134,332,501 I8N probably damaging Het
Pprc1 A G 19: 46,064,319 T759A probably damaging Het
Prom1 T C 5: 44,045,552 N213S probably benign Het
Prop1 GCTTCACT GCTTCACTTCACT 11: 50,952,036 probably null Het
Prop1 A T 11: 50,952,045 L105H probably damaging Het
Pwp2 A T 10: 78,182,494 M121K possibly damaging Het
Rap1gds1 A T 3: 138,983,748 M161K possibly damaging Het
Rps6kb2 T A 19: 4,157,003 probably benign Het
Rxfp1 A G 3: 79,644,802 S731P probably benign Het
Scfd1 T C 12: 51,390,412 V137A probably benign Het
Slc6a15 G A 10: 103,404,414 D333N probably damaging Het
Sqor T C 2: 122,785,181 V74A possibly damaging Het
Stil T A 4: 115,024,225 Y655* probably null Het
Syt14 A T 1: 192,898,859 I468K probably damaging Het
Tbc1d31 T C 15: 57,962,265 probably null Het
Tspyl5 A T 15: 33,686,849 S317T probably damaging Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttf2 T C 3: 100,954,315 T620A probably damaging Het
Usp32 G A 11: 85,055,772 Q269* probably null Het
Vsig10 T A 5: 117,338,243 V254E probably benign Het
Wdr6 C T 9: 108,572,988 A1114T probably benign Het
Zfp280d A G 9: 72,331,432 S63G probably damaging Het
Zfp607b A G 7: 27,703,796 D559G probably benign Het
Zfp934 T C 13: 62,517,954 H291R probably damaging Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACGTATTGCTGCTCAGAAG -3'
(R):5'- TGACAGGAGCCCAGATACTAG -3'

Sequencing Primer
(F):5'- TGCTGCTCAGAAGAATAAATAAACAC -3'
(R):5'- AGCCCAGATACTAGAGCTCTGG -3'
Posted On2016-04-15