Incidental Mutation 'R4909:Nabp2'
ID379307
Institutional Source Beutler Lab
Gene Symbol Nabp2
Ensembl Gene ENSMUSG00000025374
Gene Namenucleic acid binding protein 2
SynonymsNabp2, 2610036N15Rik, Obfc2b
MMRRC Submission 042511-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4909 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128401395-128411492 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 128401687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026439] [ENSMUST00000042666] [ENSMUST00000164199] [ENSMUST00000164664] [ENSMUST00000166608] [ENSMUST00000167859] [ENSMUST00000172348] [ENSMUST00000218858] [ENSMUST00000219131]
Predicted Effect probably benign
Transcript: ENSMUST00000026439
SMART Domains Protein: ENSMUSP00000026439
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042666
SMART Domains Protein: ENSMUSP00000037753
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 2.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164199
SMART Domains Protein: ENSMUSP00000128634
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164664
SMART Domains Protein: ENSMUSP00000127605
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 5.8e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166608
SMART Domains Protein: ENSMUSP00000131171
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 39 120 4.2e-9 PFAM
low complexity region 147 164 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 201 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167456
Predicted Effect probably benign
Transcript: ENSMUST00000167859
SMART Domains Protein: ENSMUSP00000131736
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 3.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172348
SMART Domains Protein: ENSMUSP00000127015
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 6.1e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179358
Predicted Effect probably benign
Transcript: ENSMUST00000218858
Predicted Effect probably benign
Transcript: ENSMUST00000219131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219222
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2B, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete perinatal lethality, fetal growth retardation, abnormal limb development, abnormal cranium morphology, small rib cage, thin and porous bones, cleft palate, oligodactyly, increased apoptosis at E12.5 and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik A T 12: 20,815,088 noncoding transcript Het
A830010M20Rik C T 5: 107,507,310 Q992* probably null Het
Aars G A 8: 111,055,083 G929D probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Actn4 A T 7: 28,898,657 L506Q probably damaging Het
Adam26a A T 8: 43,570,438 F5Y probably benign Het
Adamts5 G A 16: 85,900,066 Q68* probably null Het
Adcy9 A G 16: 4,298,754 I871T probably benign Het
Ak5 A T 3: 152,655,877 L136H probably damaging Het
Ap1g2 A G 14: 55,105,026 probably null Het
Ap2a1 G A 7: 44,906,381 T355M probably damaging Het
Ap3s2 T C 7: 79,915,241 D60G possibly damaging Het
Apold1 G A 6: 134,983,595 R4Q probably benign Het
Atp13a5 G T 16: 29,334,028 Q207K possibly damaging Het
BC035947 A C 1: 78,498,029 I622S probably damaging Het
Bmper G T 9: 23,377,725 V339F probably benign Het
C1ra A G 6: 124,522,334 D493G probably damaging Het
C3 C T 17: 57,226,830 probably null Het
Cabp4 T A 19: 4,137,121 I209F possibly damaging Het
Cacna1s A T 1: 136,079,604 H453L probably damaging Het
Camk2g A G 14: 20,792,584 V32A probably benign Het
Ccdc175 G A 12: 72,159,753 R240C probably damaging Het
Cdk13 C T 13: 17,772,403 S590N possibly damaging Het
Cfap45 A T 1: 172,529,876 T24S probably benign Het
Clca1 T G 3: 145,024,563 K174Q probably damaging Het
Col1a2 G A 6: 4,529,058 probably benign Het
Colgalt1 A T 8: 71,620,633 I323F possibly damaging Het
Cpeb3 T C 19: 37,174,233 S248G possibly damaging Het
Cpeb3 A T 19: 37,174,659 S106T probably damaging Het
Ctcfl C T 2: 173,095,398 A576T probably benign Het
Cyp4f16 T G 17: 32,550,321 V395G possibly damaging Het
Dchs1 C T 7: 105,766,255 G605S probably damaging Het
Egflam A T 15: 7,219,629 F903I probably damaging Het
Eif5a G A 11: 69,917,485 A62V possibly damaging Het
Fam217a A G 13: 34,910,406 S609P probably damaging Het
Fhad1 T A 4: 141,985,511 I206F probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fras1 T A 5: 96,708,758 M2000K probably benign Het
Frmd5 C T 2: 121,591,653 probably null Het
Gle1 T C 2: 29,936,080 L57P probably benign Het
Glrx3 C A 7: 137,445,036 N52K probably damaging Het
Grin3b A G 10: 79,977,104 *1004W probably null Het
Hectd4 T A 5: 121,263,891 F347L probably benign Het
Htra1 G A 7: 130,985,072 V462I probably benign Het
Itga11 A G 9: 62,755,299 Y518C probably damaging Het
Krtap15 T C 16: 88,829,365 F88L probably benign Het
Ktn1 A T 14: 47,706,460 R866W probably damaging Het
Lamb1 G A 12: 31,288,281 R483H probably damaging Het
Megf6 C T 4: 154,265,391 R983C probably damaging Het
Mybpc3 T A 2: 91,134,812 D1075E probably benign Het
Myo7b A T 18: 31,964,436 N1792K probably benign Het
Neil3 A G 8: 53,638,893 C7R probably damaging Het
Nxpe2 T A 9: 48,319,597 I491F possibly damaging Het
Obscn A G 11: 59,061,465 V4292A possibly damaging Het
Ogfod3 A G 11: 121,197,492 S139P probably damaging Het
Olfr374 A G 8: 72,109,581 N5S probably damaging Het
Olfr418 A T 1: 173,270,979 D268V probably damaging Het
Olfr682-ps1 C A 7: 105,128,228 V70L probably benign Het
Olfr800 A G 10: 129,660,720 I305V probably benign Het
Oog2 T C 4: 144,195,099 I211T possibly damaging Het
Oosp1 T C 19: 11,688,716 D70G probably benign Het
Padi3 T C 4: 140,795,626 D345G probably damaging Het
Pcyt2 A G 11: 120,615,420 F71L probably benign Het
Pi4k2b T C 5: 52,754,629 probably benign Het
Pigr A C 1: 130,848,458 T577P possibly damaging Het
Pirb G A 7: 3,719,362 Q161* probably null Het
Pnlip A G 19: 58,676,240 E204G possibly damaging Het
Pop7 G T 5: 137,501,899 D57E probably benign Het
Ppfia4 A T 1: 134,332,501 I8N probably damaging Het
Pprc1 A G 19: 46,064,319 T759A probably damaging Het
Prom1 T C 5: 44,045,552 N213S probably benign Het
Prop1 GCTTCACT GCTTCACTTCACT 11: 50,952,036 probably null Het
Prop1 A T 11: 50,952,045 L105H probably damaging Het
Pwp2 A T 10: 78,182,494 M121K possibly damaging Het
Rap1gds1 A T 3: 138,983,748 M161K possibly damaging Het
Rps6kb2 T A 19: 4,157,003 probably benign Het
Rxfp1 A G 3: 79,644,802 S731P probably benign Het
Scfd1 T C 12: 51,390,412 V137A probably benign Het
Slc6a15 G A 10: 103,404,414 D333N probably damaging Het
Sqor T C 2: 122,785,181 V74A possibly damaging Het
Stil T A 4: 115,024,225 Y655* probably null Het
Syt14 A T 1: 192,898,859 I468K probably damaging Het
Tbc1d31 T C 15: 57,962,265 probably null Het
Tspyl5 A T 15: 33,686,849 S317T probably damaging Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttf2 T C 3: 100,954,315 T620A probably damaging Het
Usp32 G A 11: 85,055,772 Q269* probably null Het
Vsig10 T A 5: 117,338,243 V254E probably benign Het
Wdr6 C T 9: 108,572,988 A1114T probably benign Het
Zfp280d A G 9: 72,331,432 S63G probably damaging Het
Zfp607b A G 7: 27,703,796 D559G probably benign Het
Zfp934 T C 13: 62,517,954 H291R probably damaging Het
Other mutations in Nabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Nabp2 APN 10 128408762 missense probably damaging 0.98
IGL02397:Nabp2 APN 10 128408323 missense possibly damaging 0.46
ANU22:Nabp2 UTSW 10 128408762 missense probably damaging 0.98
PIT4585001:Nabp2 UTSW 10 128408807 missense possibly damaging 0.64
R1928:Nabp2 UTSW 10 128409313 missense possibly damaging 0.89
R5031:Nabp2 UTSW 10 128409628 unclassified probably benign
R5724:Nabp2 UTSW 10 128409686 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATAGACAGCATCAGCAGGAC -3'
(R):5'- AGCTTCCGAGAACCAGAACG -3'

Sequencing Primer
(F):5'- CATCAGCAGGACAGGGGTG -3'
(R):5'- CGGAAATGGACTGAGCACCC -3'
Posted On2016-04-15