Incidental Mutation 'R4909:Adcy9'
ID379330
Institutional Source Beutler Lab
Gene Symbol Adcy9
Ensembl Gene ENSMUSG00000005580
Gene Nameadenylate cyclase 9
SynonymsD16Wsu65e, ACtp10
MMRRC Submission 042511-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R4909 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4287529-4420498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4298754 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 871 (I871T)
Ref Sequence ENSEMBL: ENSMUSP00000113498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005719] [ENSMUST00000117801] [ENSMUST00000120080]
Predicted Effect probably benign
Transcript: ENSMUST00000005719
AA Change: I871T

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005719
Gene: ENSMUSG00000005580
AA Change: I871T

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117801
AA Change: I871T

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113498
Gene: ENSMUSG00000005580
AA Change: I871T

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120080
AA Change: I634T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113421
Gene: ENSMUSG00000005580
AA Change: I634T

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 44 63 N/A INTRINSIC
CYCc 88 310 1.69e-63 SMART
transmembrane domain 554 576 N/A INTRINSIC
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
transmembrane domain 653 675 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
CYCc 786 990 1.26e-39 SMART
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. It is regulated by a family of G protein-coupled receptors, protein kinases, and calcium. The type 9 adenylyl cyclase is a widely distributed adenylyl cyclase, and it is stimulated by beta-adrenergic receptor activation but is insensitive to forskolin, calcium, and somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show an increased IgG1 response to ovalbumin challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik A T 12: 20,815,088 noncoding transcript Het
A830010M20Rik C T 5: 107,507,310 Q992* probably null Het
Aars G A 8: 111,055,083 G929D probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Actn4 A T 7: 28,898,657 L506Q probably damaging Het
Adam26a A T 8: 43,570,438 F5Y probably benign Het
Adamts5 G A 16: 85,900,066 Q68* probably null Het
Ak5 A T 3: 152,655,877 L136H probably damaging Het
Ap1g2 A G 14: 55,105,026 probably null Het
Ap2a1 G A 7: 44,906,381 T355M probably damaging Het
Ap3s2 T C 7: 79,915,241 D60G possibly damaging Het
Apold1 G A 6: 134,983,595 R4Q probably benign Het
Atp13a5 G T 16: 29,334,028 Q207K possibly damaging Het
BC035947 A C 1: 78,498,029 I622S probably damaging Het
Bmper G T 9: 23,377,725 V339F probably benign Het
C1ra A G 6: 124,522,334 D493G probably damaging Het
C3 C T 17: 57,226,830 probably null Het
Cabp4 T A 19: 4,137,121 I209F possibly damaging Het
Cacna1s A T 1: 136,079,604 H453L probably damaging Het
Camk2g A G 14: 20,792,584 V32A probably benign Het
Ccdc175 G A 12: 72,159,753 R240C probably damaging Het
Cdk13 C T 13: 17,772,403 S590N possibly damaging Het
Cfap45 A T 1: 172,529,876 T24S probably benign Het
Clca1 T G 3: 145,024,563 K174Q probably damaging Het
Col1a2 G A 6: 4,529,058 probably benign Het
Colgalt1 A T 8: 71,620,633 I323F possibly damaging Het
Cpeb3 T C 19: 37,174,233 S248G possibly damaging Het
Cpeb3 A T 19: 37,174,659 S106T probably damaging Het
Ctcfl C T 2: 173,095,398 A576T probably benign Het
Cyp4f16 T G 17: 32,550,321 V395G possibly damaging Het
Dchs1 C T 7: 105,766,255 G605S probably damaging Het
Egflam A T 15: 7,219,629 F903I probably damaging Het
Eif5a G A 11: 69,917,485 A62V possibly damaging Het
Fam217a A G 13: 34,910,406 S609P probably damaging Het
Fhad1 T A 4: 141,985,511 I206F probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fras1 T A 5: 96,708,758 M2000K probably benign Het
Frmd5 C T 2: 121,591,653 probably null Het
Gle1 T C 2: 29,936,080 L57P probably benign Het
Glrx3 C A 7: 137,445,036 N52K probably damaging Het
Grin3b A G 10: 79,977,104 *1004W probably null Het
Hectd4 T A 5: 121,263,891 F347L probably benign Het
Htra1 G A 7: 130,985,072 V462I probably benign Het
Itga11 A G 9: 62,755,299 Y518C probably damaging Het
Krtap15 T C 16: 88,829,365 F88L probably benign Het
Ktn1 A T 14: 47,706,460 R866W probably damaging Het
Lamb1 G A 12: 31,288,281 R483H probably damaging Het
Megf6 C T 4: 154,265,391 R983C probably damaging Het
Mybpc3 T A 2: 91,134,812 D1075E probably benign Het
Myo7b A T 18: 31,964,436 N1792K probably benign Het
Nabp2 A T 10: 128,401,687 probably benign Het
Neil3 A G 8: 53,638,893 C7R probably damaging Het
Nxpe2 T A 9: 48,319,597 I491F possibly damaging Het
Obscn A G 11: 59,061,465 V4292A possibly damaging Het
Ogfod3 A G 11: 121,197,492 S139P probably damaging Het
Olfr374 A G 8: 72,109,581 N5S probably damaging Het
Olfr418 A T 1: 173,270,979 D268V probably damaging Het
Olfr682-ps1 C A 7: 105,128,228 V70L probably benign Het
Olfr800 A G 10: 129,660,720 I305V probably benign Het
Oog2 T C 4: 144,195,099 I211T possibly damaging Het
Oosp1 T C 19: 11,688,716 D70G probably benign Het
Padi3 T C 4: 140,795,626 D345G probably damaging Het
Pcyt2 A G 11: 120,615,420 F71L probably benign Het
Pi4k2b T C 5: 52,754,629 probably benign Het
Pigr A C 1: 130,848,458 T577P possibly damaging Het
Pirb G A 7: 3,719,362 Q161* probably null Het
Pnlip A G 19: 58,676,240 E204G possibly damaging Het
Pop7 G T 5: 137,501,899 D57E probably benign Het
Ppfia4 A T 1: 134,332,501 I8N probably damaging Het
Pprc1 A G 19: 46,064,319 T759A probably damaging Het
Prom1 T C 5: 44,045,552 N213S probably benign Het
Prop1 GCTTCACT GCTTCACTTCACT 11: 50,952,036 probably null Het
Prop1 A T 11: 50,952,045 L105H probably damaging Het
Pwp2 A T 10: 78,182,494 M121K possibly damaging Het
Rap1gds1 A T 3: 138,983,748 M161K possibly damaging Het
Rps6kb2 T A 19: 4,157,003 probably benign Het
Rxfp1 A G 3: 79,644,802 S731P probably benign Het
Scfd1 T C 12: 51,390,412 V137A probably benign Het
Slc6a15 G A 10: 103,404,414 D333N probably damaging Het
Sqor T C 2: 122,785,181 V74A possibly damaging Het
Stil T A 4: 115,024,225 Y655* probably null Het
Syt14 A T 1: 192,898,859 I468K probably damaging Het
Tbc1d31 T C 15: 57,962,265 probably null Het
Tspyl5 A T 15: 33,686,849 S317T probably damaging Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttf2 T C 3: 100,954,315 T620A probably damaging Het
Usp32 G A 11: 85,055,772 Q269* probably null Het
Vsig10 T A 5: 117,338,243 V254E probably benign Het
Wdr6 C T 9: 108,572,988 A1114T probably benign Het
Zfp280d A G 9: 72,331,432 S63G probably damaging Het
Zfp607b A G 7: 27,703,796 D559G probably benign Het
Zfp934 T C 13: 62,517,954 H291R probably damaging Het
Other mutations in Adcy9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Adcy9 APN 16 4304582 missense probably benign
IGL00326:Adcy9 APN 16 4294696 missense probably benign
IGL00792:Adcy9 APN 16 4288539 missense probably damaging 1.00
IGL01610:Adcy9 APN 16 4418114 missense probably damaging 1.00
IGL02376:Adcy9 APN 16 4418680 missense probably benign 0.01
IGL02424:Adcy9 APN 16 4288597 missense probably damaging 1.00
IGL03097:Adcy9 UTSW 16 4418066 missense possibly damaging 0.94
PIT4243001:Adcy9 UTSW 16 4418407 missense probably damaging 1.00
R0043:Adcy9 UTSW 16 4289015 missense probably benign 0.12
R0085:Adcy9 UTSW 16 4288224 missense probably benign
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0371:Adcy9 UTSW 16 4288047 missense probably benign 0.06
R0613:Adcy9 UTSW 16 4419539 missense probably damaging 1.00
R0689:Adcy9 UTSW 16 4312804 splice site probably benign
R0744:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R0836:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R1223:Adcy9 UTSW 16 4298748 missense probably damaging 1.00
R1251:Adcy9 UTSW 16 4311531 missense probably damaging 0.99
R1689:Adcy9 UTSW 16 4297562 splice site probably null
R1922:Adcy9 UTSW 16 4311657 missense probably damaging 1.00
R1955:Adcy9 UTSW 16 4418659 missense possibly damaging 0.63
R1989:Adcy9 UTSW 16 4298727 missense probably damaging 1.00
R1998:Adcy9 UTSW 16 4297412 missense probably benign 0.00
R2321:Adcy9 UTSW 16 4288268 missense probably damaging 1.00
R3160:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3161:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R4065:Adcy9 UTSW 16 4288434 missense probably damaging 1.00
R5078:Adcy9 UTSW 16 4323907 missense probably benign 0.00
R5870:Adcy9 UTSW 16 4418368 missense probably damaging 1.00
R5968:Adcy9 UTSW 16 4298742 missense probably damaging 1.00
R5975:Adcy9 UTSW 16 4311567 missense probably damaging 0.98
R6014:Adcy9 UTSW 16 4418819 missense probably damaging 1.00
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6081:Adcy9 UTSW 16 4294681 missense probably benign
R6192:Adcy9 UTSW 16 4287954 missense probably benign
R6604:Adcy9 UTSW 16 4304407 missense probably damaging 0.98
R6739:Adcy9 UTSW 16 4418794 missense probably benign
R6829:Adcy9 UTSW 16 4307154 critical splice donor site probably null
R6986:Adcy9 UTSW 16 4311577 missense probably damaging 0.99
R7491:Adcy9 UTSW 16 4418809 missense possibly damaging 0.51
R7561:Adcy9 UTSW 16 4418164 missense probably damaging 1.00
R7614:Adcy9 UTSW 16 4418224 missense probably damaging 1.00
R7803:Adcy9 UTSW 16 4304380 missense probably benign 0.11
R7993:Adcy9 UTSW 16 4418002 missense probably damaging 1.00
R8444:Adcy9 UTSW 16 4288623 missense probably damaging 1.00
R8519:Adcy9 UTSW 16 4288128 missense possibly damaging 0.57
R8546:Adcy9 UTSW 16 4418905 missense probably benign 0.02
R8751:Adcy9 UTSW 16 4311628 missense probably damaging 0.97
X0023:Adcy9 UTSW 16 4323916 missense probably benign 0.00
Z1176:Adcy9 UTSW 16 4307232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCATGCTTCCTATTTTAAGAGG -3'
(R):5'- CCAGGTGGGCATCAGAAATG -3'

Sequencing Primer
(F):5'- CATGCTTCCTATTTTAAGAGGGCAGC -3'
(R):5'- CTTCTGTGTCCAGAATGG -3'
Posted On2016-04-15