Mutagenetix > Incidental Mutation

Incidental Mutation 'R4910:Cnot1'

379414

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

042512-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4910 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 95733231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1836 (I1836N)

Ref Sequence

ENSEMBL: ENSMUSP00000096073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: I1831N

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I1831N

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: I1836N

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I1836N

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: I1829N

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212302

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212369

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212535

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212712

Predicted Effect

probably benign
Transcript: ENSMUST00000213006

Meta Mutation Damage Score

0.4710

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.6%
20x: 86.1%

Validation Efficiency

95% (144/151)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 123 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,998,199	T3016K	probably damaging	Het
Adam3	T	A	8: 24,694,305	I560L	probably benign	Het
Agxt	T	C	1: 93,135,714	F113L	probably benign	Het
Aknad1	T	A	3: 108,781,252		probably null	Het
Alpk2	T	A	18: 65,266,286	K2074*	probably null	Het
Apob	A	G	12: 8,007,848	Y2077C	probably damaging	Het
Arhgap17	A	T	7: 123,308,377	L254Q	probably damaging	Het
Arhgap26	T	A	18: 38,993,637		probably benign	Het
Arhgef5	A	G	6: 43,272,828	D171G	probably benign	Het
Arid1b	T	A	17: 5,342,203	S2003T	probably damaging	Het
Armc5	T	G	7: 128,240,728	L406R	possibly damaging	Het
Arsb	T	C	13: 93,771,977	V67A	probably benign	Het
Aspm	A	G	1: 139,491,543	Y2982C	probably damaging	Het
Btbd7	A	G	12: 102,808,048	L487P	probably damaging	Het
Card11	C	G	5: 140,874,414	D1063H	probably damaging	Het
Ccdc186	G	A	19: 56,798,691	T615M	probably damaging	Het
Cd101	T	A	3: 100,993,889	T960S	probably benign	Het
Cdca7l	C	A	12: 117,873,785	S191*	probably null	Het
Cemip	A	T	7: 83,997,411	I143N	probably damaging	Het
Cep170	C	T	1: 176,782,263	E161K	possibly damaging	Het
Chrm2	A	T	6: 36,524,233	T342S	probably benign	Het
Cib2	A	G	9: 54,549,879	F34L	probably benign	Het
Col4a3	C	A	1: 82,672,679	P552Q	unknown	Het
Cp	T	A	3: 19,989,224		probably benign	Het
Cul3	C	T	1: 80,290,089	V112I	probably benign	Het
Dcdc5	A	G	2: 106,365,550		noncoding transcript	Het
Disp1	A	T	1: 183,135,463	V133E	probably damaging	Het
Dlg4	A	G	11: 70,030,925	D30G	probably damaging	Het
Dopey1	C	T	9: 86,492,061	T191I	probably damaging	Het
Enam	T	G	5: 88,502,314	S561A	probably benign	Het
Fbxw8	G	T	5: 118,125,027		probably null	Het
Filip1	A	G	9: 79,817,932	V1135A	probably benign	Het
Galnt6	T	C	15: 100,716,178	T81A	probably benign	Het
Ghdc	T	C	11: 100,766,988	K472E	probably benign	Het
Gm10568	T	G	1: 3,680,941		noncoding transcript	Het
Gm4788	T	G	1: 139,774,563	D61A	probably damaging	Het
Gm4953	T	A	1: 159,168,359		noncoding transcript	Het
Gm6871	T	A	7: 41,573,592	H24L	probably benign	Het
Gm8298	T	A	3: 59,869,014		probably null	Het
Gpr155	G	A	2: 73,367,538	Q413*	probably null	Het
Grhl2	A	G	15: 37,291,676		probably null	Het
Ighv1-31	G	C	12: 114,829,508	S36*	probably null	Het
Ighv8-5	A	G	12: 115,067,842	S26P	probably damaging	Het
Igkv17-134	A	C	6: 67,720,926		probably benign	Het
Igkv5-48	A	C	6: 69,726,849	L24R	probably damaging	Het
Isg20l2	T	A	3: 87,939,263	V340E	probably damaging	Het
Lrrtm1	A	G	6: 77,244,901	Y447C	probably damaging	Het
Ltbp1	T	C	17: 75,327,292	S855P	probably damaging	Het
Mgat4e	A	T	1: 134,541,864	N147K	probably damaging	Het
Mlc1	A	G	15: 88,958,212	L315P	possibly damaging	Het
Mrgpra2a	A	G	7: 47,426,544	V322A	probably benign	Het
Mroh7	T	C	4: 106,709,955		probably null	Het
Mybpc1	T	A	10: 88,555,724	K304*	probably null	Het
Nlrp14	A	C	7: 107,186,583	D622A	possibly damaging	Het
Nlrp1b	T	A	11: 71,217,277	H466L	probably benign	Het
Nlrp4d	T	A	7: 10,378,409		noncoding transcript	Het
Nrxn3	A	G	12: 89,260,360	E628G	possibly damaging	Het
Nup133	T	C	8: 123,927,131	R530G	possibly damaging	Het
Nup98	A	G	7: 102,195,800	S21P	unknown	Het
Olfr1307	A	T	2: 111,945,078	I126K	possibly damaging	Het
Olfr168	T	C	16: 19,530,018	T301A	probably benign	Het
Olfr173	T	A	16: 58,797,442	T135S	probably benign	Het
Olfr251	T	A	9: 38,378,742	V287E	probably null	Het
Olfr671	G	A	7: 104,975,479	P169S	possibly damaging	Het
Olfr753-ps1	T	C	17: 37,170,043	I202V	probably benign	Het
Olfr798	T	C	10: 129,625,807	T85A	probably damaging	Het
Otog	A	T	7: 46,264,062	Y773F	probably damaging	Het
Otog	A	T	7: 46,298,534	I2320F	probably damaging	Het
Otogl	T	C	10: 107,879,517	S433G	probably benign	Het
Pcdhb17	A	T	18: 37,485,159	M1L	possibly damaging	Het
Pde7b	T	A	10: 20,724,734		probably benign	Het
Pgm2	T	C	4: 99,963,527	V207A	probably damaging	Het
Pkd1	T	A	17: 24,572,687	V1116E	probably damaging	Het
Pkd1l1	T	A	11: 8,929,360	Y497F	possibly damaging	Het
Pomgnt2	T	C	9: 121,982,947	N256S	probably benign	Het
Pot1a	A	T	6: 25,746,021		probably benign	Het
Prdm9	T	C	17: 15,544,323	T732A	probably benign	Het
Prg4	T	A	1: 150,455,823		probably benign	Het
Ptpro	T	C	6: 137,368,338	V114A	probably damaging	Het
Pyurf	A	G	6: 57,691,948	S20P	unknown	Het
Rasgrf1	A	G	9: 89,976,752	T488A	probably benign	Het
Rassf8	A	T	6: 145,815,280	K111*	probably null	Het
Reps1	A	T	10: 18,107,688	E426D	probably damaging	Het
Robo2	T	C	16: 73,933,778	K982R	probably damaging	Het
Rps23	T	C	13: 90,923,752		probably null	Het
Scamp4	T	A	10: 80,609,671	V56E	probably damaging	Het
Serpina1c	C	T	12: 103,895,032	V408I	probably benign	Het
Sigirr	A	G	7: 141,093,788	W49R	probably damaging	Het
Slc17a6	A	T	7: 51,658,741	H271L	possibly damaging	Het
Slc7a5	G	T	8: 121,885,122	T389K	probably damaging	Het
Slf1	T	A	13: 77,043,880	H945L	probably benign	Het
Slit3	T	C	11: 35,632,722	S662P	probably damaging	Het
Snta1	C	A	2: 154,377,018	E466*	probably null	Het
Sowaha	A	G	11: 53,478,445	L488P	probably damaging	Het
Spata17	C	A	1: 187,194,011	V41F	probably damaging	Het
Spta1	T	A	1: 174,217,863		probably null	Het
Srrm2	T	A	17: 23,815,388		probably benign	Het
Stard13	T	C	5: 151,062,527	N388S	probably benign	Het
Stmn3	T	C	2: 181,308,837	K59E	probably damaging	Het
Sval1	A	G	6: 41,955,444	N76S	probably benign	Het
Svep1	T	C	4: 58,096,276	H1448R	possibly damaging	Het
Sycp2	A	T	2: 178,358,224	D986E	probably benign	Het
Sytl5	C	T	X: 9,915,602	P181L	possibly damaging	Het
Tbkbp1	G	A	11: 97,139,130	S400L	probably benign	Het
Tesc	G	T	5: 118,056,466		probably benign	Het
Tjp1	C	T	7: 65,343,727	G33R	probably damaging	Het
Tlr11	C	A	14: 50,362,889	F777L	probably benign	Het
Tmem156	A	G	5: 65,091,462		probably benign	Het
Top3a	A	G	11: 60,752,378		probably benign	Het
Tpcn1	A	G	5: 120,556,519	W162R	probably damaging	Het
Tpd52l2	A	T	2: 181,515,212		probably benign	Het
Trim80	G	A	11: 115,446,455	G381D	probably damaging	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Vmn2r117	TC	T	17: 23,479,513		probably null	Het
Vmn2r56	T	A	7: 12,715,535	I259F	possibly damaging	Het
Vmn2r59	T	C	7: 42,043,653	T508A	probably benign	Het
Wdr73	A	G	7: 80,891,708	V362A	probably damaging	Het
Zdhhc21	G	T	4: 82,820,331	T207K	possibly damaging	Het
Zfp120	T	A	2: 150,117,952	Q150L	probably damaging	Het
Zfp212	C	A	6: 47,931,499	Q471K	possibly damaging	Het
Zfp804b	C	T	5: 6,770,540	G841D	possibly damaging	Het
Znfx1	A	T	2: 167,036,804	M1884K	probably damaging	Het
Znfx1	G	T	2: 167,037,482	A1658D	probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TAATAGTGGAGTAATCACACCCTAC -3'
(R):5'- TTTCAGGGTCCTTGGGAAGC -3'

Sequencing Primer
(F):5'- GTGGAGTAATCACACCCTACTTATG -3'
(R):5'- CCTAATCAGCTATGGTGAGGTCC -3'

Posted On

2016-04-15