Incidental Mutation 'R0244:Cep152'
ID37943
Institutional Source Beutler Lab
Gene Symbol Cep152
Ensembl Gene ENSMUSG00000068394
Gene Namecentrosomal protein 152
Synonyms
MMRRC Submission 038482-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0244 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125563088-125625113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125564214 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1466 (E1466G)
Ref Sequence ENSEMBL: ENSMUSP00000087208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089776]
Predicted Effect probably benign
Transcript: ENSMUST00000089776
AA Change: E1466G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087208
Gene: ENSMUSG00000068394
AA Change: E1466G

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
coiled coil region 228 481 N/A INTRINSIC
low complexity region 582 593 N/A INTRINSIC
coiled coil region 602 651 N/A INTRINSIC
coiled coil region 692 770 N/A INTRINSIC
low complexity region 780 793 N/A INTRINSIC
coiled coil region 835 868 N/A INTRINSIC
coiled coil region 954 1038 N/A INTRINSIC
coiled coil region 1205 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved with centrosome function. Mutations in this gene have been associated with primary microcephaly (MCPH4). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Embryos homozygous for a null allele exhibit reduced numbers of centrosomes and cilia, increased apoptosis, and midgestation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,491 probably null Het
Adamdec1 A T 14: 68,568,723 C434* probably null Het
Adprhl1 A G 8: 13,242,391 probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Arel1 T C 12: 84,920,693 T786A probably damaging Het
Arhgap26 A G 18: 39,363,131 K117R probably benign Het
Atp6v0b C T 4: 117,884,622 G204D probably damaging Het
Bace2 T A 16: 97,436,773 probably null Het
Camk4 G A 18: 33,179,625 probably null Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Ces3b T C 8: 105,092,635 F441S probably damaging Het
Cfap52 T C 11: 67,926,382 T562A possibly damaging Het
Clca3a2 C A 3: 144,813,898 M238I possibly damaging Het
Cntnap5c A T 17: 58,102,168 D467V probably damaging Het
Col7a1 T A 9: 108,972,184 probably null Het
Cstf1 A G 2: 172,377,710 N247S possibly damaging Het
Dffb G T 4: 153,974,615 N68K probably benign Het
Duox2 C T 2: 122,291,860 G595S probably benign Het
Eftud2 T A 11: 102,864,725 I228F probably damaging Het
Elmo3 T C 8: 105,309,171 V578A probably benign Het
Elp2 A G 18: 24,631,471 D625G possibly damaging Het
Ep300 C T 15: 81,640,128 P1386S unknown Het
Fam120b A G 17: 15,417,637 D610G probably damaging Het
Fastk A T 5: 24,442,178 probably benign Het
Fbxl6 A G 15: 76,537,191 S252P probably damaging Het
Fbxo43 T C 15: 36,161,793 K423E probably damaging Het
Filip1 T A 9: 79,819,462 E625V possibly damaging Het
Fkbp9 T A 6: 56,856,378 Y283* probably null Het
Gigyf2 T A 1: 87,379,015 D142E possibly damaging Het
Gm10142 T C 10: 77,716,014 probably null Het
Golga5 T C 12: 102,476,188 V262A probably benign Het
Hectd4 T C 5: 121,329,605 V2539A probably benign Het
Ica1 G T 6: 8,653,632 S335* probably null Het
Itga1 A T 13: 115,006,897 probably benign Het
Itgb1 T C 8: 128,717,685 probably benign Het
Itpr1 G A 6: 108,473,589 V1960I probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kprp C T 3: 92,825,411 V111I probably benign Het
Lamc3 T C 2: 31,940,721 I1490T probably damaging Het
Lcp1 A T 14: 75,227,001 D554V possibly damaging Het
Lgi3 A G 14: 70,534,698 T228A probably benign Het
Lipa A T 19: 34,501,541 F260I probably damaging Het
Lrriq1 C T 10: 103,215,773 E373K probably damaging Het
Map6 G A 7: 99,336,836 G649D probably benign Het
Mccc1 A G 3: 35,990,047 probably null Het
Mical3 A T 6: 120,957,722 S1799T probably benign Het
Mmp23 T A 4: 155,652,132 T151S probably damaging Het
Myo1d T A 11: 80,674,708 N401I probably damaging Het
Myo9b T A 8: 71,321,813 S323T probably damaging Het
Nbn G T 4: 15,979,353 W446L probably benign Het
Nedd1 A T 10: 92,716,265 probably benign Het
Ngef C A 1: 87,487,962 probably benign Het
Nup153 A T 13: 46,693,936 N672K probably benign Het
Olfr1308 T C 2: 111,961,016 N19S probably benign Het
Olfr149 T A 9: 39,702,173 I199F probably damaging Het
Olfr1509 T C 14: 52,450,512 V33A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Palm2 T G 4: 57,710,177 V374G possibly damaging Het
Pdlim3 C A 8: 45,908,460 probably benign Het
Pmfbp1 G A 8: 109,541,673 E951K probably damaging Het
Pop1 T A 15: 34,515,891 C548* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ptpdc1 A T 13: 48,585,980 N658K probably benign Het
Ptprk A C 10: 28,206,225 E63D possibly damaging Het
Rtf1 C T 2: 119,732,877 R712W probably damaging Het
Samd7 A C 3: 30,751,073 T2P probably benign Het
Sft2d1 A G 17: 8,319,422 T52A probably benign Het
Slc25a26 A G 6: 94,510,833 H91R probably damaging Het
Slc5a4a A G 10: 76,189,152 E621G possibly damaging Het
Slf1 A T 13: 77,126,632 L28* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorcs2 G A 5: 36,397,553 probably benign Het
Tacc2 T C 7: 130,751,825 probably benign Het
Tas2r140 A G 6: 133,055,327 V156A possibly damaging Het
Terf2ip C A 8: 112,018,164 T371K possibly damaging Het
Tifa C T 3: 127,796,888 L103F probably damaging Het
Tmco3 A G 8: 13,292,037 N104D probably damaging Het
Tmem259 T A 10: 79,978,963 D240V probably damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Trps1 T C 15: 50,664,743 N725D probably damaging Het
Ttn C T 2: 76,814,806 V12902M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Unc79 A G 12: 103,112,891 K1772E probably damaging Het
Vwde C T 6: 13,193,126 V405I probably benign Het
Wdr18 T A 10: 79,966,408 D290E probably damaging Het
Wdr92 T C 11: 17,229,851 L284P probably damaging Het
Wwc2 G A 8: 47,900,721 A126V probably benign Het
Zfp882 A T 8: 71,913,523 I105F possibly damaging Het
Zfp942 A T 17: 21,928,572 C359S probably benign Het
Other mutations in Cep152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cep152 APN 2 125563888 missense probably benign 0.01
IGL00561:Cep152 APN 2 125563723 nonsense probably null
IGL01082:Cep152 APN 2 125569545 splice site probably benign
IGL01420:Cep152 APN 2 125563652 missense possibly damaging 0.49
IGL01832:Cep152 APN 2 125618494 nonsense probably null
IGL02106:Cep152 APN 2 125602936 splice site probably null
IGL02124:Cep152 APN 2 125563461 missense probably benign 0.23
IGL02349:Cep152 APN 2 125594956 missense probably damaging 0.99
IGL02541:Cep152 APN 2 125605354 missense probably damaging 1.00
IGL02659:Cep152 APN 2 125579549 missense probably damaging 0.96
IGL02711:Cep152 APN 2 125563942 missense possibly damaging 0.93
IGL02737:Cep152 APN 2 125586474 missense possibly damaging 0.71
IGL03060:Cep152 APN 2 125619987 splice site probably benign
IGL03095:Cep152 APN 2 125618451 missense probably benign 0.00
IGL03186:Cep152 APN 2 125563975 missense probably benign
IGL03306:Cep152 APN 2 125605408 missense possibly damaging 0.90
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0079:Cep152 UTSW 2 125618453 missense possibly damaging 0.92
R0390:Cep152 UTSW 2 125576869 splice site probably benign
R0462:Cep152 UTSW 2 125583934 missense possibly damaging 0.64
R0480:Cep152 UTSW 2 125581719 missense possibly damaging 0.95
R0595:Cep152 UTSW 2 125595063 missense probably damaging 0.99
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R1634:Cep152 UTSW 2 125583889 missense probably benign 0.00
R1664:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1693:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1887:Cep152 UTSW 2 125620305 missense probably benign 0.00
R1930:Cep152 UTSW 2 125618371 critical splice donor site probably null
R2178:Cep152 UTSW 2 125580034 splice site probably null
R2225:Cep152 UTSW 2 125581784 missense probably damaging 1.00
R2324:Cep152 UTSW 2 125563462 missense probably benign 0.38
R2416:Cep152 UTSW 2 125564172 nonsense probably null
R2845:Cep152 UTSW 2 125587974 missense probably damaging 1.00
R3753:Cep152 UTSW 2 125625052 unclassified probably benign
R4212:Cep152 UTSW 2 125620001 missense probably benign 0.00
R4304:Cep152 UTSW 2 125563723 nonsense probably null
R4371:Cep152 UTSW 2 125613047 missense probably damaging 1.00
R4399:Cep152 UTSW 2 125587980 missense possibly damaging 0.63
R4536:Cep152 UTSW 2 125602947 splice site probably null
R4713:Cep152 UTSW 2 125587948 missense possibly damaging 0.79
R4777:Cep152 UTSW 2 125564095 missense probably benign 0.29
R4779:Cep152 UTSW 2 125568892 missense possibly damaging 0.52
R4785:Cep152 UTSW 2 125586329 critical splice donor site probably null
R4816:Cep152 UTSW 2 125563754 missense probably damaging 1.00
R4847:Cep152 UTSW 2 125618474 missense possibly damaging 0.62
R4898:Cep152 UTSW 2 125586381 missense probably benign 0.03
R4934:Cep152 UTSW 2 125611096 missense possibly damaging 0.52
R4997:Cep152 UTSW 2 125586351 missense probably benign 0.00
R5068:Cep152 UTSW 2 125571816 missense probably benign 0.25
R5183:Cep152 UTSW 2 125566638 missense probably damaging 1.00
R5198:Cep152 UTSW 2 125587624 missense probably benign
R5261:Cep152 UTSW 2 125564205 missense probably benign 0.06
R5272:Cep152 UTSW 2 125611030 missense probably benign 0.27
R5284:Cep152 UTSW 2 125580021 missense probably damaging 1.00
R6029:Cep152 UTSW 2 125563632 missense probably benign 0.44
R6155:Cep152 UTSW 2 125581700 missense probably benign
R6239:Cep152 UTSW 2 125579412 missense probably benign 0.40
R6590:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6690:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6754:Cep152 UTSW 2 125587668 missense probably damaging 0.99
R6798:Cep152 UTSW 2 125566527 splice site probably null
R6816:Cep152 UTSW 2 125595027 missense probably damaging 1.00
R6977:Cep152 UTSW 2 125568822 critical splice donor site probably null
R7125:Cep152 UTSW 2 125566673 nonsense probably null
R7146:Cep152 UTSW 2 125614405 missense probably benign 0.06
R7588:Cep152 UTSW 2 125569626 missense probably damaging 1.00
R7852:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7883:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R7935:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7966:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
X0009:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0010:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0011:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0014:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0017:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0021:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0022:Cep152 UTSW 2 125620063 missense probably benign 0.07
X0023:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0028:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0033:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0064:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0067:Cep152 UTSW 2 125614386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCGTGCAAGTCAAAGCCTCC -3'
(R):5'- GCAGAAACTTCCTGCTCGACCATC -3'

Sequencing Primer
(F):5'- GTCAAAGCCTCCCTCGC -3'
(R):5'- GTCAGCTCTTGAAGTGTAGAACC -3'
Posted On2013-05-23