Incidental Mutation 'R4911:Slc5a9'
ID 379495
Institutional Source Beutler Lab
Gene Symbol Slc5a9
Ensembl Gene ENSMUSG00000028544
Gene Name solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms SGLT4
MMRRC Submission 042513-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R4911 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 111732571-111759993 bp(-) (GRCm39)
Type of Mutation splice site (43 bp from exon)
DNA Base Change (assembly) C to A at 111748941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102719] [ENSMUST00000102720] [ENSMUST00000102721] [ENSMUST00000128340]
AlphaFold Q8VDT1
Predicted Effect probably null
Transcript: ENSMUST00000102719
SMART Domains Protein: ENSMUSP00000099780
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102720
SMART Domains Protein: ENSMUSP00000099781
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102721
SMART Domains Protein: ENSMUSP00000099782
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128340
SMART Domains Protein: ENSMUSP00000120546
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
Pfam:SSF 23 255 9.3e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149922
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (149/153)
Allele List at MGI
Other mutations in this stock
Total: 132 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs A G 5: 125,583,224 (GRCm39) D260G possibly damaging Het
Aadacl4 T A 4: 144,340,362 (GRCm39) L29H probably damaging Het
Abca7 T C 10: 79,848,022 (GRCm39) probably null Het
Adgre1 G A 17: 57,754,832 (GRCm39) M643I possibly damaging Het
Adgrl2 A T 3: 148,596,099 (GRCm39) M79K probably damaging Het
Ankrd55 T A 13: 112,459,573 (GRCm39) probably null Het
Aopep A T 13: 63,318,753 (GRCm39) probably null Het
Arhgap21 A G 2: 20,863,800 (GRCm39) I1257T probably damaging Het
Arhgap26 T A 18: 39,126,690 (GRCm39) probably benign Het
Arhgap39 A G 15: 76,622,005 (GRCm39) S199P probably damaging Het
Arhgef5 A G 6: 43,249,762 (GRCm39) D171G probably benign Het
Atp7a T C X: 105,163,980 (GRCm39) V1305A probably damaging Het
B3gnt3 T A 8: 72,145,578 (GRCm39) R263S probably benign Het
B9d1 A C 11: 61,398,497 (GRCm39) D59A probably benign Het
Bag2 A T 1: 33,787,357 (GRCm39) I55N probably benign Het
Bank1 T C 3: 135,990,004 (GRCm39) I29V probably benign Het
Bbs2 A T 8: 94,815,743 (GRCm39) D174E probably damaging Het
Bmp8b T C 4: 123,009,030 (GRCm39) W203R probably damaging Het
Cacnb2 A T 2: 14,986,151 (GRCm39) E359D possibly damaging Het
Camp T A 9: 109,676,651 (GRCm39) probably null Het
Casp4 C T 9: 5,328,580 (GRCm39) probably benign Het
Ccdc110 A T 8: 46,395,944 (GRCm39) T612S probably benign Het
Cd209b T A 8: 3,976,640 (GRCm39) probably null Het
Cemip T C 7: 83,632,461 (GRCm39) D367G probably damaging Het
Cers5 T A 15: 99,644,960 (GRCm39) N131I probably damaging Het
Cfhr4 T G 1: 139,702,301 (GRCm39) D61A probably damaging Het
Chd5 T G 4: 152,445,129 (GRCm39) V370G probably damaging Het
Cipc C A 12: 86,999,531 (GRCm39) Q20K probably benign Het
Cnr2 T A 4: 135,644,512 (GRCm39) F197I possibly damaging Het
Col7a1 G A 9: 108,804,287 (GRCm39) G2233S unknown Het
Dcdc2b T A 4: 129,505,060 (GRCm39) I125F possibly damaging Het
Ddi2 A G 4: 141,411,713 (GRCm39) S400P probably benign Het
Ddx31 C A 2: 28,794,696 (GRCm39) T664K probably benign Het
Dhx30 C A 9: 109,929,992 (GRCm39) G35C probably damaging Het
Dmxl2 G A 9: 54,318,937 (GRCm39) T1576I probably damaging Het
Dnah1 T C 14: 31,017,280 (GRCm39) Y1510C probably damaging Het
Dnah2 C T 11: 69,389,930 (GRCm39) probably null Het
Dock10 C A 1: 80,583,953 (GRCm39) G163C probably damaging Het
Edar T C 10: 58,457,146 (GRCm39) N144S probably benign Het
Elavl2 T A 4: 91,196,915 (GRCm39) E54D possibly damaging Het
Enam T G 5: 88,650,173 (GRCm39) S561A probably benign Het
Ercc5 C A 1: 44,206,031 (GRCm39) H315N possibly damaging Het
Esp31 A G 17: 38,955,552 (GRCm39) E65G possibly damaging Het
Faap100 T C 11: 120,262,939 (GRCm39) I806M probably benign Het
Fbxw21 T C 9: 108,974,731 (GRCm39) Y263C probably damaging Het
Fsip2 T A 2: 82,811,837 (GRCm39) S2719T possibly damaging Het
Fv1 T C 4: 147,953,875 (GRCm39) V147A probably benign Het
Gal T C 19: 3,461,590 (GRCm39) E65G probably benign Het
Galnt2l A G 8: 123,807,343 (GRCm39) probably benign Het
Galnt6 T C 15: 100,614,059 (GRCm39) T81A probably benign Het
Gcc2 A G 10: 58,106,261 (GRCm39) E399G probably damaging Het
Gfi1b A T 2: 28,500,114 (GRCm39) C306S probably damaging Het
Gm10654 T A 8: 71,384,496 (GRCm39) noncoding transcript Het
Gm4953 T A 1: 158,995,929 (GRCm39) noncoding transcript Het
Gorasp2 T C 2: 70,518,683 (GRCm39) probably benign Het
Gse1 T C 8: 121,295,205 (GRCm39) probably benign Het
H2-D1 A G 17: 35,484,973 (GRCm39) E278G probably damaging Het
Herc2 T C 7: 55,877,640 (GRCm39) L4569P probably damaging Het
Hgs T A 11: 120,368,028 (GRCm39) S246T probably damaging Het
Hs2st1 T C 3: 144,170,843 (GRCm39) T110A probably benign Het
Hydin A G 8: 111,322,070 (GRCm39) Y4574C probably benign Het
Ighv1-23 C A 12: 114,728,372 (GRCm39) V17F possibly damaging Het
Ighv8-14 A T 12: 115,772,185 (GRCm39) noncoding transcript Het
Igsf21 C T 4: 139,761,934 (GRCm39) R248H probably benign Het
Il22b T C 10: 118,130,894 (GRCm39) M1V probably null Het
Il23r T C 6: 67,400,545 (GRCm39) N595S probably benign Het
Il5ra G T 6: 106,692,629 (GRCm39) P372Q probably damaging Het
Inppl1 A G 7: 101,481,516 (GRCm39) V222A possibly damaging Het
Ints10 T C 8: 69,279,964 (GRCm39) V697A probably damaging Het
Isg15 T A 4: 156,284,217 (GRCm39) T104S probably benign Het
Kif11 A G 19: 37,406,385 (GRCm39) T983A probably benign Het
Kif3b A T 2: 153,159,212 (GRCm39) K338* probably null Het
Kpna2 T A 11: 106,881,545 (GRCm39) I362F probably damaging Het
Lama2 G A 10: 27,014,923 (GRCm39) T1595M probably damaging Het
Lrrc36 A G 8: 106,153,567 (GRCm39) T126A probably benign Het
Lrrk1 T A 7: 65,945,202 (GRCm39) D604V probably damaging Het
Map7d1 T C 4: 126,130,484 (GRCm39) K409E probably damaging Het
Mast2 T C 4: 116,210,254 (GRCm39) T110A probably benign Het
Micall2 G A 5: 139,702,580 (GRCm39) T221M probably damaging Het
Morc2b T A 17: 33,356,351 (GRCm39) N474Y probably damaging Het
Myo1e T A 9: 70,250,378 (GRCm39) M528K probably benign Het
Nlrp1c-ps G T 11: 71,151,195 (GRCm39) noncoding transcript Het
Nostrin T C 2: 68,991,486 (GRCm39) S160P possibly damaging Het
Nup133 T C 8: 124,653,870 (GRCm39) R530G possibly damaging Het
Or2f2 T A 6: 42,767,138 (GRCm39) L55H probably damaging Het
Or5p64 T C 7: 107,855,244 (GRCm39) I34V possibly damaging Het
Or8c16 A G 9: 38,130,392 (GRCm39) E91G probably damaging Het
Pabpc4l A T 3: 46,400,597 (GRCm39) M349K possibly damaging Het
Pah G A 10: 87,406,129 (GRCm39) G256S probably benign Het
Pigk T C 3: 152,445,841 (GRCm39) S151P probably damaging Het
Plcd4 A C 1: 74,603,572 (GRCm39) T658P possibly damaging Het
Pld4 A T 12: 112,730,951 (GRCm39) S178C probably benign Het
Polr1a G A 6: 71,886,213 (GRCm39) E23K possibly damaging Het
Pomt1 T C 2: 32,131,691 (GRCm39) S127P probably damaging Het
Pon2 A G 6: 5,269,029 (GRCm39) V215A possibly damaging Het
Ppp3cb A T 14: 20,559,508 (GRCm39) M416K probably damaging Het
Prdm1 A T 10: 44,318,048 (GRCm39) N273K possibly damaging Het
Prg4 T A 1: 150,331,574 (GRCm39) probably benign Het
Prkn G T 17: 11,059,359 (GRCm39) probably benign Het
Ptch1 G A 13: 63,670,866 (GRCm39) T888M probably damaging Het
Pusl1 T G 4: 155,975,899 (GRCm39) probably benign Het
Rapgef6 A T 11: 54,513,143 (GRCm39) E122D probably damaging Het
Rif1 C T 2: 52,000,530 (GRCm39) T1328I probably damaging Het
Rngtt T G 4: 33,500,292 (GRCm39) probably null Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Samd1 A G 8: 84,725,618 (GRCm39) probably benign Het
Scamp5 A T 9: 57,358,735 (GRCm39) F14I probably damaging Het
Shank3 C T 15: 89,388,547 (GRCm39) R380C probably damaging Het
Shisal2a T C 4: 108,234,658 (GRCm39) T70A probably benign Het
Slc1a4 C A 11: 20,282,166 (GRCm39) A103S probably damaging Het
Slc39a14 A G 14: 70,547,371 (GRCm39) V325A probably benign Het
Spata6l G A 19: 28,874,903 (GRCm39) probably benign Het
Spta1 T A 1: 174,013,213 (GRCm39) S375T probably damaging Het
Sval1 A G 6: 41,932,378 (GRCm39) N76S probably benign Het
Synpo C T 18: 60,762,936 (GRCm39) probably benign Het
Sytl5 C T X: 9,781,841 (GRCm39) P181L possibly damaging Het
Tacc1 A G 8: 25,672,622 (GRCm39) M111T possibly damaging Het
Tec T C 5: 72,913,694 (GRCm39) D613G probably benign Het
Tecpr2 C T 12: 110,897,921 (GRCm39) T391I possibly damaging Het
Thop1 G A 10: 80,909,125 (GRCm39) G52D probably damaging Het
Tmco5 T A 2: 116,722,689 (GRCm39) V270D possibly damaging Het
Ttn C T 2: 76,556,973 (GRCm39) E28265K possibly damaging Het
Tuft1 T C 3: 94,542,750 (GRCm39) D72G probably damaging Het
Tyrp1 C T 4: 80,769,144 (GRCm39) probably benign Het
Usp9y T C Y: 1,308,041 (GRCm39) D2265G probably damaging Het
Vmn2r104 G A 17: 20,250,288 (GRCm39) A661V probably benign Het
Vwa5a A T 9: 38,649,268 (GRCm39) N672I probably benign Het
Wdr95 A T 5: 149,535,157 (GRCm39) K772* probably null Het
Ybx1 T C 4: 119,140,010 (GRCm39) T106A probably benign Het
Ypel3 T C 7: 126,376,961 (GRCm39) S14P probably benign Het
Zfp518a T A 19: 40,903,972 (GRCm39) S1300R probably benign Het
Zscan5b A T 7: 6,242,189 (GRCm39) *469Y probably null Het
Other mutations in Slc5a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Slc5a9 APN 4 111,755,766 (GRCm39) missense probably damaging 0.99
IGL00837:Slc5a9 APN 4 111,750,887 (GRCm39) intron probably benign
IGL01556:Slc5a9 APN 4 111,755,833 (GRCm39) missense probably benign 0.00
IGL01807:Slc5a9 APN 4 111,734,737 (GRCm39) makesense probably null
IGL01816:Slc5a9 APN 4 111,755,811 (GRCm39) missense probably damaging 1.00
IGL02066:Slc5a9 APN 4 111,744,719 (GRCm39) missense probably damaging 1.00
IGL02370:Slc5a9 APN 4 111,734,826 (GRCm39) missense probably benign 0.01
IGL02491:Slc5a9 APN 4 111,753,549 (GRCm39) missense probably damaging 0.99
IGL02971:Slc5a9 APN 4 111,747,497 (GRCm39) missense possibly damaging 0.58
IGL03008:Slc5a9 APN 4 111,748,138 (GRCm39) missense probably benign 0.14
R0365:Slc5a9 UTSW 4 111,749,033 (GRCm39) nonsense probably null
R0559:Slc5a9 UTSW 4 111,742,779 (GRCm39) missense probably benign 0.02
R0659:Slc5a9 UTSW 4 111,741,068 (GRCm39) missense possibly damaging 0.82
R1454:Slc5a9 UTSW 4 111,741,161 (GRCm39) missense probably benign 0.04
R2006:Slc5a9 UTSW 4 111,737,423 (GRCm39) missense probably benign
R2014:Slc5a9 UTSW 4 111,753,546 (GRCm39) missense possibly damaging 0.76
R2024:Slc5a9 UTSW 4 111,747,728 (GRCm39) missense probably damaging 1.00
R2076:Slc5a9 UTSW 4 111,742,770 (GRCm39) missense possibly damaging 0.76
R2152:Slc5a9 UTSW 4 111,750,420 (GRCm39) missense possibly damaging 0.76
R3156:Slc5a9 UTSW 4 111,747,421 (GRCm39) missense possibly damaging 0.80
R4566:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4568:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4579:Slc5a9 UTSW 4 111,750,384 (GRCm39) missense probably damaging 1.00
R4656:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4657:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4700:Slc5a9 UTSW 4 111,748,134 (GRCm39) missense possibly damaging 0.64
R4889:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4891:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4948:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4953:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R5222:Slc5a9 UTSW 4 111,755,808 (GRCm39) missense possibly damaging 0.55
R5376:Slc5a9 UTSW 4 111,750,414 (GRCm39) missense possibly damaging 0.80
R5502:Slc5a9 UTSW 4 111,750,366 (GRCm39) nonsense probably null
R5851:Slc5a9 UTSW 4 111,742,797 (GRCm39) missense probably benign
R6030:Slc5a9 UTSW 4 111,742,725 (GRCm39) missense possibly damaging 0.64
R6030:Slc5a9 UTSW 4 111,742,725 (GRCm39) missense possibly damaging 0.64
R6125:Slc5a9 UTSW 4 111,741,002 (GRCm39) missense probably damaging 1.00
R6326:Slc5a9 UTSW 4 111,737,450 (GRCm39) missense probably benign
R6438:Slc5a9 UTSW 4 111,749,022 (GRCm39) missense probably benign 0.00
R7105:Slc5a9 UTSW 4 111,755,892 (GRCm39) missense probably benign
R7166:Slc5a9 UTSW 4 111,741,036 (GRCm39) missense probably benign 0.04
R7489:Slc5a9 UTSW 4 111,741,113 (GRCm39) missense probably damaging 1.00
R7599:Slc5a9 UTSW 4 111,734,937 (GRCm39) missense probably benign
R7662:Slc5a9 UTSW 4 111,734,737 (GRCm39) makesense probably null
R7762:Slc5a9 UTSW 4 111,747,371 (GRCm39) missense probably damaging 0.99
R7992:Slc5a9 UTSW 4 111,747,729 (GRCm39) missense probably benign 0.37
R8851:Slc5a9 UTSW 4 111,755,790 (GRCm39) missense probably damaging 0.97
R8918:Slc5a9 UTSW 4 111,741,147 (GRCm39) missense probably benign 0.00
R9387:Slc5a9 UTSW 4 111,750,864 (GRCm39) missense probably damaging 1.00
R9425:Slc5a9 UTSW 4 111,734,803 (GRCm39) missense probably damaging 0.96
R9483:Slc5a9 UTSW 4 111,747,418 (GRCm39) missense probably damaging 1.00
R9506:Slc5a9 UTSW 4 111,750,439 (GRCm39) nonsense probably null
X0012:Slc5a9 UTSW 4 111,750,511 (GRCm39) missense probably damaging 0.99
Z1177:Slc5a9 UTSW 4 111,749,013 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGTACAACTCATCCTCAGCAGG -3'
(R):5'- TGGGTGCTGACTTTCTACAGAC -3'

Sequencing Primer
(F):5'- AGCAGGACCCCATGTCTCTC -3'
(R):5'- ACAGACTGATATCTTCTCTGGAGC -3'
Posted On 2016-04-15