Incidental Mutation 'R4911:Tec'
ID 379510
Institutional Source Beutler Lab
Gene Symbol Tec
Ensembl Gene ENSMUSG00000029217
Gene Name tec protein tyrosine kinase
Synonyms
MMRRC Submission 042513-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R4911 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 72913059-73025826 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72913694 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 613 (D613G)
Ref Sequence ENSEMBL: ENSMUSP00000109224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071944] [ENSMUST00000073843] [ENSMUST00000113594] [ENSMUST00000113604] [ENSMUST00000126481] [ENSMUST00000138842] [ENSMUST00000197313] [ENSMUST00000198464]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071944
AA Change: D613G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071836
Gene: ENSMUSG00000029217
AA Change: D613G

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073843
AA Change: D591G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000073509
Gene: ENSMUSG00000029217
AA Change: D591G

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 230 2.85e-3 SMART
SH2 222 313 9.96e-28 SMART
TyrKc 347 596 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113594
AA Change: D613G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109224
Gene: ENSMUSG00000029217
AA Change: D613G

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113604
SMART Domains Protein: ENSMUSP00000109234
Gene: ENSMUSG00000054892

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126481
SMART Domains Protein: ENSMUSP00000123606
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138842
SMART Domains Protein: ENSMUSP00000120155
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155342
SMART Domains Protein: ENSMUSP00000118980
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
BTK 2 33 8.62e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197313
SMART Domains Protein: ENSMUSP00000143476
Gene: ENSMUSG00000054892

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 138 1.2e-9 SMART
SH2 126 215 3.1e-35 SMART
TyrKc 249 498 1.2e-136 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197923
Predicted Effect probably benign
Transcript: ENSMUST00000198464
SMART Domains Protein: ENSMUSP00000143002
Gene: ENSMUSG00000054892

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
SH3 31 87 6.3e-19 SMART
SH2 94 183 5.4e-36 SMART
TyrKc 217 466 1.2e-136 SMART
Meta Mutation Damage Score 0.1551 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (149/153)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tec family of non-receptor protein-tyrosine kinases containing a pleckstrin homology domain. Tec family kinases are involved in the intracellular signaling mechanisms of cytokine receptors, lymphocyte surface antigens, heterotrimeric G-protein coupled receptors, and integrin molecules. They are also key players in the regulation of the immune functions. Tec kinase is an integral component of T cell signaling and has a distinct role in T cell activation. This gene may be associated with myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a minor reduction in platetet aggregation in response to threshold concentrations of collagen-related peptide or collagen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 132 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs A G 5: 125,583,224 (GRCm39) D260G possibly damaging Het
Aadacl4 T A 4: 144,340,362 (GRCm39) L29H probably damaging Het
Abca7 T C 10: 79,848,022 (GRCm39) probably null Het
Adgre1 G A 17: 57,754,832 (GRCm39) M643I possibly damaging Het
Adgrl2 A T 3: 148,596,099 (GRCm39) M79K probably damaging Het
Ankrd55 T A 13: 112,459,573 (GRCm39) probably null Het
Aopep A T 13: 63,318,753 (GRCm39) probably null Het
Arhgap21 A G 2: 20,863,800 (GRCm39) I1257T probably damaging Het
Arhgap26 T A 18: 39,126,690 (GRCm39) probably benign Het
Arhgap39 A G 15: 76,622,005 (GRCm39) S199P probably damaging Het
Arhgef5 A G 6: 43,249,762 (GRCm39) D171G probably benign Het
Atp7a T C X: 105,163,980 (GRCm39) V1305A probably damaging Het
B3gnt3 T A 8: 72,145,578 (GRCm39) R263S probably benign Het
B9d1 A C 11: 61,398,497 (GRCm39) D59A probably benign Het
Bag2 A T 1: 33,787,357 (GRCm39) I55N probably benign Het
Bank1 T C 3: 135,990,004 (GRCm39) I29V probably benign Het
Bbs2 A T 8: 94,815,743 (GRCm39) D174E probably damaging Het
Bmp8b T C 4: 123,009,030 (GRCm39) W203R probably damaging Het
Cacnb2 A T 2: 14,986,151 (GRCm39) E359D possibly damaging Het
Camp T A 9: 109,676,651 (GRCm39) probably null Het
Casp4 C T 9: 5,328,580 (GRCm39) probably benign Het
Ccdc110 A T 8: 46,395,944 (GRCm39) T612S probably benign Het
Cd209b T A 8: 3,976,640 (GRCm39) probably null Het
Cemip T C 7: 83,632,461 (GRCm39) D367G probably damaging Het
Cers5 T A 15: 99,644,960 (GRCm39) N131I probably damaging Het
Cfhr4 T G 1: 139,702,301 (GRCm39) D61A probably damaging Het
Chd5 T G 4: 152,445,129 (GRCm39) V370G probably damaging Het
Cipc C A 12: 86,999,531 (GRCm39) Q20K probably benign Het
Cnr2 T A 4: 135,644,512 (GRCm39) F197I possibly damaging Het
Col7a1 G A 9: 108,804,287 (GRCm39) G2233S unknown Het
Dcdc2b T A 4: 129,505,060 (GRCm39) I125F possibly damaging Het
Ddi2 A G 4: 141,411,713 (GRCm39) S400P probably benign Het
Ddx31 C A 2: 28,794,696 (GRCm39) T664K probably benign Het
Dhx30 C A 9: 109,929,992 (GRCm39) G35C probably damaging Het
Dmxl2 G A 9: 54,318,937 (GRCm39) T1576I probably damaging Het
Dnah1 T C 14: 31,017,280 (GRCm39) Y1510C probably damaging Het
Dnah2 C T 11: 69,389,930 (GRCm39) probably null Het
Dock10 C A 1: 80,583,953 (GRCm39) G163C probably damaging Het
Edar T C 10: 58,457,146 (GRCm39) N144S probably benign Het
Elavl2 T A 4: 91,196,915 (GRCm39) E54D possibly damaging Het
Enam T G 5: 88,650,173 (GRCm39) S561A probably benign Het
Ercc5 C A 1: 44,206,031 (GRCm39) H315N possibly damaging Het
Esp31 A G 17: 38,955,552 (GRCm39) E65G possibly damaging Het
Faap100 T C 11: 120,262,939 (GRCm39) I806M probably benign Het
Fbxw21 T C 9: 108,974,731 (GRCm39) Y263C probably damaging Het
Fsip2 T A 2: 82,811,837 (GRCm39) S2719T possibly damaging Het
Fv1 T C 4: 147,953,875 (GRCm39) V147A probably benign Het
Gal T C 19: 3,461,590 (GRCm39) E65G probably benign Het
Galnt2l A G 8: 123,807,343 (GRCm39) probably benign Het
Galnt6 T C 15: 100,614,059 (GRCm39) T81A probably benign Het
Gcc2 A G 10: 58,106,261 (GRCm39) E399G probably damaging Het
Gfi1b A T 2: 28,500,114 (GRCm39) C306S probably damaging Het
Gm10654 T A 8: 71,384,496 (GRCm39) noncoding transcript Het
Gm4953 T A 1: 158,995,929 (GRCm39) noncoding transcript Het
Gorasp2 T C 2: 70,518,683 (GRCm39) probably benign Het
Gse1 T C 8: 121,295,205 (GRCm39) probably benign Het
H2-D1 A G 17: 35,484,973 (GRCm39) E278G probably damaging Het
Herc2 T C 7: 55,877,640 (GRCm39) L4569P probably damaging Het
Hgs T A 11: 120,368,028 (GRCm39) S246T probably damaging Het
Hs2st1 T C 3: 144,170,843 (GRCm39) T110A probably benign Het
Hydin A G 8: 111,322,070 (GRCm39) Y4574C probably benign Het
Ighv1-23 C A 12: 114,728,372 (GRCm39) V17F possibly damaging Het
Ighv8-14 A T 12: 115,772,185 (GRCm39) noncoding transcript Het
Igsf21 C T 4: 139,761,934 (GRCm39) R248H probably benign Het
Il22b T C 10: 118,130,894 (GRCm39) M1V probably null Het
Il23r T C 6: 67,400,545 (GRCm39) N595S probably benign Het
Il5ra G T 6: 106,692,629 (GRCm39) P372Q probably damaging Het
Inppl1 A G 7: 101,481,516 (GRCm39) V222A possibly damaging Het
Ints10 T C 8: 69,279,964 (GRCm39) V697A probably damaging Het
Isg15 T A 4: 156,284,217 (GRCm39) T104S probably benign Het
Kif11 A G 19: 37,406,385 (GRCm39) T983A probably benign Het
Kif3b A T 2: 153,159,212 (GRCm39) K338* probably null Het
Kpna2 T A 11: 106,881,545 (GRCm39) I362F probably damaging Het
Lama2 G A 10: 27,014,923 (GRCm39) T1595M probably damaging Het
Lrrc36 A G 8: 106,153,567 (GRCm39) T126A probably benign Het
Lrrk1 T A 7: 65,945,202 (GRCm39) D604V probably damaging Het
Map7d1 T C 4: 126,130,484 (GRCm39) K409E probably damaging Het
Mast2 T C 4: 116,210,254 (GRCm39) T110A probably benign Het
Micall2 G A 5: 139,702,580 (GRCm39) T221M probably damaging Het
Morc2b T A 17: 33,356,351 (GRCm39) N474Y probably damaging Het
Myo1e T A 9: 70,250,378 (GRCm39) M528K probably benign Het
Nlrp1c-ps G T 11: 71,151,195 (GRCm39) noncoding transcript Het
Nostrin T C 2: 68,991,486 (GRCm39) S160P possibly damaging Het
Nup133 T C 8: 124,653,870 (GRCm39) R530G possibly damaging Het
Or2f2 T A 6: 42,767,138 (GRCm39) L55H probably damaging Het
Or5p64 T C 7: 107,855,244 (GRCm39) I34V possibly damaging Het
Or8c16 A G 9: 38,130,392 (GRCm39) E91G probably damaging Het
Pabpc4l A T 3: 46,400,597 (GRCm39) M349K possibly damaging Het
Pah G A 10: 87,406,129 (GRCm39) G256S probably benign Het
Pigk T C 3: 152,445,841 (GRCm39) S151P probably damaging Het
Plcd4 A C 1: 74,603,572 (GRCm39) T658P possibly damaging Het
Pld4 A T 12: 112,730,951 (GRCm39) S178C probably benign Het
Polr1a G A 6: 71,886,213 (GRCm39) E23K possibly damaging Het
Pomt1 T C 2: 32,131,691 (GRCm39) S127P probably damaging Het
Pon2 A G 6: 5,269,029 (GRCm39) V215A possibly damaging Het
Ppp3cb A T 14: 20,559,508 (GRCm39) M416K probably damaging Het
Prdm1 A T 10: 44,318,048 (GRCm39) N273K possibly damaging Het
Prg4 T A 1: 150,331,574 (GRCm39) probably benign Het
Prkn G T 17: 11,059,359 (GRCm39) probably benign Het
Ptch1 G A 13: 63,670,866 (GRCm39) T888M probably damaging Het
Pusl1 T G 4: 155,975,899 (GRCm39) probably benign Het
Rapgef6 A T 11: 54,513,143 (GRCm39) E122D probably damaging Het
Rif1 C T 2: 52,000,530 (GRCm39) T1328I probably damaging Het
Rngtt T G 4: 33,500,292 (GRCm39) probably null Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Samd1 A G 8: 84,725,618 (GRCm39) probably benign Het
Scamp5 A T 9: 57,358,735 (GRCm39) F14I probably damaging Het
Shank3 C T 15: 89,388,547 (GRCm39) R380C probably damaging Het
Shisal2a T C 4: 108,234,658 (GRCm39) T70A probably benign Het
Slc1a4 C A 11: 20,282,166 (GRCm39) A103S probably damaging Het
Slc39a14 A G 14: 70,547,371 (GRCm39) V325A probably benign Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Spata6l G A 19: 28,874,903 (GRCm39) probably benign Het
Spta1 T A 1: 174,013,213 (GRCm39) S375T probably damaging Het
Sval1 A G 6: 41,932,378 (GRCm39) N76S probably benign Het
Synpo C T 18: 60,762,936 (GRCm39) probably benign Het
Sytl5 C T X: 9,781,841 (GRCm39) P181L possibly damaging Het
Tacc1 A G 8: 25,672,622 (GRCm39) M111T possibly damaging Het
Tecpr2 C T 12: 110,897,921 (GRCm39) T391I possibly damaging Het
Thop1 G A 10: 80,909,125 (GRCm39) G52D probably damaging Het
Tmco5 T A 2: 116,722,689 (GRCm39) V270D possibly damaging Het
Ttn C T 2: 76,556,973 (GRCm39) E28265K possibly damaging Het
Tuft1 T C 3: 94,542,750 (GRCm39) D72G probably damaging Het
Tyrp1 C T 4: 80,769,144 (GRCm39) probably benign Het
Usp9y T C Y: 1,308,041 (GRCm39) D2265G probably damaging Het
Vmn2r104 G A 17: 20,250,288 (GRCm39) A661V probably benign Het
Vwa5a A T 9: 38,649,268 (GRCm39) N672I probably benign Het
Wdr95 A T 5: 149,535,157 (GRCm39) K772* probably null Het
Ybx1 T C 4: 119,140,010 (GRCm39) T106A probably benign Het
Ypel3 T C 7: 126,376,961 (GRCm39) S14P probably benign Het
Zfp518a T A 19: 40,903,972 (GRCm39) S1300R probably benign Het
Zscan5b A T 7: 6,242,189 (GRCm39) *469Y probably null Het
Other mutations in Tec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Tec APN 5 72,926,111 (GRCm39) missense probably damaging 1.00
IGL00980:Tec APN 5 72,944,141 (GRCm39) missense probably damaging 1.00
IGL01986:Tec APN 5 72,939,348 (GRCm39) nonsense probably null
IGL02505:Tec APN 5 72,946,587 (GRCm39) missense probably damaging 1.00
IGL02522:Tec APN 5 72,946,515 (GRCm39) missense probably benign 0.01
IGL02527:Tec APN 5 72,936,758 (GRCm39) splice site probably null
IGL03292:Tec APN 5 72,914,707 (GRCm39) missense probably null 0.98
development UTSW 5 72,939,520 (GRCm39) critical splice acceptor site probably null
technocrat UTSW 5 72,939,355 (GRCm39) missense probably null 0.98
IGL02988:Tec UTSW 5 72,926,090 (GRCm39) missense possibly damaging 0.95
PIT4696001:Tec UTSW 5 72,931,178 (GRCm39) missense possibly damaging 0.73
R0254:Tec UTSW 5 72,941,081 (GRCm39) missense probably benign 0.12
R0254:Tec UTSW 5 72,920,899 (GRCm39) splice site probably benign
R0646:Tec UTSW 5 72,980,840 (GRCm39) missense probably damaging 1.00
R1122:Tec UTSW 5 72,936,792 (GRCm39) missense probably damaging 0.96
R1495:Tec UTSW 5 72,944,098 (GRCm39) missense probably damaging 1.00
R1617:Tec UTSW 5 72,939,448 (GRCm39) missense probably damaging 0.97
R3905:Tec UTSW 5 72,917,705 (GRCm39) missense probably damaging 1.00
R3953:Tec UTSW 5 72,939,520 (GRCm39) critical splice acceptor site probably null
R3954:Tec UTSW 5 72,939,520 (GRCm39) critical splice acceptor site probably null
R3955:Tec UTSW 5 72,939,520 (GRCm39) critical splice acceptor site probably null
R3981:Tec UTSW 5 72,980,942 (GRCm39) utr 5 prime probably benign
R4061:Tec UTSW 5 72,980,752 (GRCm39) unclassified probably benign
R4389:Tec UTSW 5 72,939,350 (GRCm39) missense probably benign
R4507:Tec UTSW 5 72,917,701 (GRCm39) missense probably damaging 1.00
R4689:Tec UTSW 5 72,980,980 (GRCm39) start gained probably benign
R4702:Tec UTSW 5 72,941,074 (GRCm39) missense possibly damaging 0.71
R4776:Tec UTSW 5 72,926,119 (GRCm39) missense probably benign 0.38
R4923:Tec UTSW 5 72,939,365 (GRCm39) nonsense probably null
R4932:Tec UTSW 5 72,917,736 (GRCm39) nonsense probably null
R5595:Tec UTSW 5 72,926,087 (GRCm39) missense possibly damaging 0.91
R7211:Tec UTSW 5 72,939,355 (GRCm39) missense probably null 0.98
R7404:Tec UTSW 5 72,920,961 (GRCm39) missense probably damaging 1.00
R7465:Tec UTSW 5 72,931,223 (GRCm39) missense probably damaging 1.00
R7526:Tec UTSW 5 72,943,362 (GRCm39) missense probably benign
R7548:Tec UTSW 5 72,917,693 (GRCm39) missense probably damaging 1.00
R7699:Tec UTSW 5 72,943,367 (GRCm39) missense possibly damaging 0.60
R7700:Tec UTSW 5 72,943,367 (GRCm39) missense possibly damaging 0.60
R8021:Tec UTSW 5 72,914,812 (GRCm39) missense probably benign 0.03
R8217:Tec UTSW 5 72,921,602 (GRCm39) missense probably benign 0.13
R8704:Tec UTSW 5 72,926,105 (GRCm39) missense probably damaging 1.00
R9287:Tec UTSW 5 72,926,117 (GRCm39) missense probably damaging 1.00
R9731:Tec UTSW 5 72,939,439 (GRCm39) missense probably benign 0.01
Z1177:Tec UTSW 5 72,939,358 (GRCm39) missense possibly damaging 0.90
Z1177:Tec UTSW 5 72,926,050 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGACCATCTGTGCAGC -3'
(R):5'- AAACGAACCCAGCAGCTTTGG -3'

Sequencing Primer
(F):5'- GCAAAGCAGCCACTGAGCTC -3'
(R):5'- CCAGCAGCTTTGGGGTTG -3'
Posted On 2016-04-15