Incidental Mutation 'R4911:Tacc1'
ID379530
Institutional Source Beutler Lab
Gene Symbol Tacc1
Ensembl Gene ENSMUSG00000065954
Gene Nametransforming, acidic coiled-coil containing protein 1
Synonyms4833447E04Rik, B230378H13Rik, Tacc1
MMRRC Submission 042513-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R4911 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25154552-25256588 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25182606 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 111 (M111T)
Ref Sequence ENSEMBL: ENSMUSP00000147353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084030] [ENSMUST00000084512] [ENSMUST00000209827] [ENSMUST00000210016] [ENSMUST00000210488] [ENSMUST00000210767] [ENSMUST00000210933] [ENSMUST00000211622]
Predicted Effect probably benign
Transcript: ENSMUST00000084030
AA Change: M202T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081043
Gene: ENSMUSG00000065954
AA Change: M202T

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
Pfam:TACC 569 769 3.6e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084512
SMART Domains Protein: ENSMUSP00000081560
Gene: ENSMUSG00000065954

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
Pfam:TACC 160 366 3.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209827
Predicted Effect probably benign
Transcript: ENSMUST00000210016
Predicted Effect possibly damaging
Transcript: ENSMUST00000210488
AA Change: M111T

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000210767
Predicted Effect probably benign
Transcript: ENSMUST00000210933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211584
Predicted Effect probably benign
Transcript: ENSMUST00000211622
AA Change: M202T

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1074 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (149/153)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus may represent a breast cancer candidate gene. It is located close to FGFR1 on a region of chromosome 8 that is amplified in some breast cancers. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 132 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,170,939 probably null Het
4430402I18Rik G A 19: 28,897,503 probably benign Het
Aacs A G 5: 125,506,160 D260G possibly damaging Het
Aadacl4 T A 4: 144,613,792 L29H probably damaging Het
Abca7 T C 10: 80,012,188 probably null Het
Adgre1 G A 17: 57,447,832 M643I possibly damaging Het
Adgrl2 A T 3: 148,890,463 M79K probably damaging Het
Ankrd55 T A 13: 112,323,039 probably null Het
Arhgap21 A G 2: 20,858,989 I1257T probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgap39 A G 15: 76,737,805 S199P probably damaging Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Atp7a T C X: 106,120,374 V1305A probably damaging Het
B3gnt3 T A 8: 71,692,934 R263S probably benign Het
B9d1 A C 11: 61,507,671 D59A probably benign Het
Bag2 A T 1: 33,748,276 I55N probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bbs2 A T 8: 94,089,115 D174E probably damaging Het
Bmp8b T C 4: 123,115,237 W203R probably damaging Het
Cacnb2 A T 2: 14,981,340 E359D possibly damaging Het
Camp T A 9: 109,847,583 probably null Het
Casp4 C T 9: 5,328,580 probably benign Het
Ccdc110 A T 8: 45,942,907 T612S probably benign Het
Cd209b T A 8: 3,926,640 probably null Het
Cemip T C 7: 83,983,253 D367G probably damaging Het
Cers5 T A 15: 99,747,079 N131I probably damaging Het
Chd5 T G 4: 152,360,672 V370G probably damaging Het
Cipc C A 12: 86,952,757 Q20K probably benign Het
Cnr2 T A 4: 135,917,201 F197I possibly damaging Het
Col7a1 G A 9: 108,975,219 G2233S unknown Het
Dcdc2b T A 4: 129,611,267 I125F possibly damaging Het
Ddi2 A G 4: 141,684,402 S400P probably benign Het
Ddx31 C A 2: 28,904,684 T664K probably benign Het
Dhx30 C A 9: 110,100,924 G35C probably damaging Het
Dmxl2 G A 9: 54,411,653 T1576I probably damaging Het
Dnah1 T C 14: 31,295,323 Y1510C probably damaging Het
Dnah2 C T 11: 69,499,104 probably null Het
Dock10 C A 1: 80,606,236 G163C probably damaging Het
Edar T C 10: 58,621,324 N144S probably benign Het
Elavl2 T A 4: 91,308,678 E54D possibly damaging Het
Enam T G 5: 88,502,314 S561A probably benign Het
Ercc5 C A 1: 44,166,871 H315N possibly damaging Het
Esp31 A G 17: 38,644,661 E65G possibly damaging Het
Faap100 T C 11: 120,372,113 I806M probably benign Het
Fam159a T C 4: 108,377,461 T70A probably benign Het
Fbxw21 T C 9: 109,145,663 Y263C probably damaging Het
Fsip2 T A 2: 82,981,493 S2719T possibly damaging Het
Fv1 T C 4: 147,869,418 V147A probably benign Het
Gal T C 19: 3,411,590 E65G probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Gcc2 A G 10: 58,270,439 E399G probably damaging Het
Gfi1b A T 2: 28,610,102 C306S probably damaging Het
Gm10654 T A 8: 70,931,852 noncoding transcript Het
Gm20388 A G 8: 123,080,604 probably benign Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gorasp2 T C 2: 70,688,339 probably benign Het
Gse1 T C 8: 120,568,466 probably benign Het
H2-D1 A G 17: 35,265,997 E278G probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hgs T A 11: 120,477,202 S246T probably damaging Het
Hs2st1 T C 3: 144,465,082 T110A probably benign Het
Hydin A G 8: 110,595,438 Y4574C probably benign Het
Ighv1-23 C A 12: 114,764,752 V17F possibly damaging Het
Ighv8-14 A T 12: 115,808,565 noncoding transcript Het
Igsf21 C T 4: 140,034,623 R248H probably benign Het
Il23r T C 6: 67,423,561 N595S probably benign Het
Il5ra G T 6: 106,715,668 P372Q probably damaging Het
Iltifb T C 10: 118,294,989 M1V probably null Het
Inppl1 A G 7: 101,832,309 V222A possibly damaging Het
Ints10 T C 8: 68,827,312 V697A probably damaging Het
Isg15 T A 4: 156,199,760 T104S probably benign Het
Kif11 A G 19: 37,417,937 T983A probably benign Het
Kif3b A T 2: 153,317,292 K338* probably null Het
Kpna2 T A 11: 106,990,719 I362F probably damaging Het
Lama2 G A 10: 27,138,927 T1595M probably damaging Het
Lrrc36 A G 8: 105,426,935 T126A probably benign Het
Lrrk1 T A 7: 66,295,454 D604V probably damaging Het
Map7d1 T C 4: 126,236,691 K409E probably damaging Het
Mast2 T C 4: 116,353,057 T110A probably benign Het
Micall2 G A 5: 139,716,825 T221M probably damaging Het
Morc2b T A 17: 33,137,377 N474Y probably damaging Het
Myo1e T A 9: 70,343,096 M528K probably benign Het
Nlrp1c-ps G T 11: 71,260,369 noncoding transcript Het
Nostrin T C 2: 69,161,142 S160P possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Olfr452 T A 6: 42,790,204 L55H probably damaging Het
Olfr488 T C 7: 108,256,037 I34V possibly damaging Het
Olfr894 A G 9: 38,219,096 E91G probably damaging Het
Pabpc4l A T 3: 46,446,162 M349K possibly damaging Het
Pah G A 10: 87,570,267 G256S probably benign Het
Park2 G T 17: 10,840,472 probably benign Het
Pigk T C 3: 152,740,204 S151P probably damaging Het
Plcd4 A C 1: 74,564,413 T658P possibly damaging Het
Pld4 A T 12: 112,764,517 S178C probably benign Het
Polr1a G A 6: 71,909,229 E23K possibly damaging Het
Pomt1 T C 2: 32,241,679 S127P probably damaging Het
Pon2 A G 6: 5,269,029 V215A possibly damaging Het
Ppp3cb A T 14: 20,509,440 M416K probably damaging Het
Prdm1 A T 10: 44,442,052 N273K possibly damaging Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptch1 G A 13: 63,523,052 T888M probably damaging Het
Pusl1 T G 4: 155,891,442 probably benign Het
Rapgef6 A T 11: 54,622,317 E122D probably damaging Het
Rif1 C T 2: 52,110,518 T1328I probably damaging Het
Rngtt T G 4: 33,500,292 probably null Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd1 A G 8: 83,998,989 probably benign Het
Scamp5 A T 9: 57,451,452 F14I probably damaging Het
Shank3 C T 15: 89,504,344 R380C probably damaging Het
Slc1a4 C A 11: 20,332,166 A103S probably damaging Het
Slc39a14 A G 14: 70,309,922 V325A probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Synpo C T 18: 60,629,864 probably benign Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tec T C 5: 72,756,351 D613G probably benign Het
Tecpr2 C T 12: 110,931,487 T391I possibly damaging Het
Thop1 G A 10: 81,073,291 G52D probably damaging Het
Tmco5 T A 2: 116,892,208 V270D possibly damaging Het
Ttn C T 2: 76,726,629 E28265K possibly damaging Het
Tuft1 T C 3: 94,635,443 D72G probably damaging Het
Tyrp1 C T 4: 80,850,907 probably benign Het
Usp9y T C Y: 1,308,041 D2265G probably damaging Het
Vmn2r104 G A 17: 20,030,026 A661V probably benign Het
Vwa5a A T 9: 38,737,972 N672I probably benign Het
Wdr95 A T 5: 149,611,692 K772* probably null Het
Ybx1 T C 4: 119,282,813 T106A probably benign Het
Ypel3 T C 7: 126,777,789 S14P probably benign Het
Zfp518a T A 19: 40,915,528 S1300R probably benign Het
Zscan5b A T 7: 6,239,190 *469Y probably null Het
Other mutations in Tacc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Tacc1 APN 8 25175217 missense probably damaging 1.00
IGL02273:Tacc1 APN 8 25159781 missense probably damaging 1.00
IGL02728:Tacc1 APN 8 25175219 missense probably damaging 1.00
IGL02738:Tacc1 APN 8 25201143 missense probably damaging 1.00
R0194:Tacc1 UTSW 8 25182376 missense probably benign 0.45
R0617:Tacc1 UTSW 8 25178004 splice site probably benign
R1469:Tacc1 UTSW 8 25182255 missense probably benign 0.00
R1469:Tacc1 UTSW 8 25182255 missense probably benign 0.00
R1785:Tacc1 UTSW 8 25164493 missense probably damaging 1.00
R1786:Tacc1 UTSW 8 25164493 missense probably damaging 1.00
R1889:Tacc1 UTSW 8 25175253 missense probably damaging 0.99
R2131:Tacc1 UTSW 8 25164493 missense probably damaging 1.00
R2133:Tacc1 UTSW 8 25164493 missense probably damaging 1.00
R2419:Tacc1 UTSW 8 25182813 missense possibly damaging 0.90
R4740:Tacc1 UTSW 8 25182565 missense possibly damaging 0.94
R4793:Tacc1 UTSW 8 25182389 missense possibly damaging 0.96
R5177:Tacc1 UTSW 8 25201221 missense probably damaging 1.00
R5320:Tacc1 UTSW 8 25181865 missense probably benign 0.31
R5377:Tacc1 UTSW 8 25182283 missense possibly damaging 0.94
R5452:Tacc1 UTSW 8 25164415 missense probably null 1.00
R5930:Tacc1 UTSW 8 25182199 missense probably benign
R5952:Tacc1 UTSW 8 25181995 missense possibly damaging 0.85
R6767:Tacc1 UTSW 8 25240800 start codon destroyed probably null
R7200:Tacc1 UTSW 8 25241640 unclassified probably benign
R7464:Tacc1 UTSW 8 25164464 missense probably damaging 1.00
R7521:Tacc1 UTSW 8 25175252 missense possibly damaging 0.82
R7599:Tacc1 UTSW 8 25201285 start codon destroyed probably damaging 1.00
R8050:Tacc1 UTSW 8 25169214 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCAGCACACTAGGATTCGCG -3'
(R):5'- GGAACACGATGTTAGCAAGATCTC -3'

Sequencing Primer
(F):5'- ACTAGGATTCGCGTTCTGATCCAAG -3'
(R):5'- CACGATGTTAGCAAGATCTCAGTAG -3'
Posted On2016-04-15