Incidental Mutation 'R0244:Ago1'
ID 37955
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
MMRRC Submission 038482-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.810) question?
Stock # R0244 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126328805-126362376 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126357499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 59 (I59F)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect possibly damaging
Transcript: ENSMUST00000097888
AA Change: I59F

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: I59F

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149425
Predicted Effect probably benign
Transcript: ENSMUST00000176315
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Meta Mutation Damage Score 0.3507 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,806,172 (GRCm39) C434* probably null Het
Adprhl1 A G 8: 13,292,391 (GRCm39) probably benign Het
Arel1 T C 12: 84,967,467 (GRCm39) T786A probably damaging Het
Arhgap26 A G 18: 39,496,184 (GRCm39) K117R probably benign Het
Atp6v0b C T 4: 117,741,819 (GRCm39) G204D probably damaging Het
Bace2 T A 16: 97,237,973 (GRCm39) probably null Het
Bltp2 T A 11: 78,177,317 (GRCm39) probably null Het
Camk4 G A 18: 33,312,678 (GRCm39) probably null Het
Cdh26 C T 2: 178,123,425 (GRCm39) R675C possibly damaging Het
Cep152 T C 2: 125,406,134 (GRCm39) E1466G probably benign Het
Ces3b T C 8: 105,819,267 (GRCm39) F441S probably damaging Het
Cfap52 T C 11: 67,817,208 (GRCm39) T562A possibly damaging Het
Clca3a2 C A 3: 144,519,659 (GRCm39) M238I possibly damaging Het
Cntnap5c A T 17: 58,409,163 (GRCm39) D467V probably damaging Het
Col7a1 T A 9: 108,801,252 (GRCm39) probably null Het
Cstf1 A G 2: 172,219,630 (GRCm39) N247S possibly damaging Het
Dffb G T 4: 154,059,072 (GRCm39) N68K probably benign Het
Dnaaf10 T C 11: 17,179,851 (GRCm39) L284P probably damaging Het
Duox2 C T 2: 122,122,341 (GRCm39) G595S probably benign Het
Eftud2 T A 11: 102,755,551 (GRCm39) I228F probably damaging Het
Elmo3 T C 8: 106,035,803 (GRCm39) V578A probably benign Het
Elp2 A G 18: 24,764,528 (GRCm39) D625G possibly damaging Het
Ep300 C T 15: 81,524,329 (GRCm39) P1386S unknown Het
Fam120b A G 17: 15,637,899 (GRCm39) D610G probably damaging Het
Fastk A T 5: 24,647,176 (GRCm39) probably benign Het
Fbxl6 A G 15: 76,421,391 (GRCm39) S252P probably damaging Het
Fbxo43 T C 15: 36,161,939 (GRCm39) K423E probably damaging Het
Filip1 T A 9: 79,726,744 (GRCm39) E625V possibly damaging Het
Fkbp9 T A 6: 56,833,363 (GRCm39) Y283* probably null Het
Gigyf2 T A 1: 87,306,737 (GRCm39) D142E possibly damaging Het
Gm10142 T C 10: 77,551,848 (GRCm39) probably null Het
Golga5 T C 12: 102,442,447 (GRCm39) V262A probably benign Het
Hectd4 T C 5: 121,467,668 (GRCm39) V2539A probably benign Het
Ica1 G T 6: 8,653,632 (GRCm39) S335* probably null Het
Itga1 A T 13: 115,143,433 (GRCm39) probably benign Het
Itgb1 T C 8: 129,444,166 (GRCm39) probably benign Het
Itpr1 G A 6: 108,450,550 (GRCm39) V1960I probably benign Het
Kcnh4 C T 11: 100,637,758 (GRCm39) G633E probably benign Het
Kprp C T 3: 92,732,718 (GRCm39) V111I probably benign Het
Lamc3 T C 2: 31,830,733 (GRCm39) I1490T probably damaging Het
Lcp1 A T 14: 75,464,441 (GRCm39) D554V possibly damaging Het
Lgi3 A G 14: 70,772,138 (GRCm39) T228A probably benign Het
Lipa A T 19: 34,478,941 (GRCm39) F260I probably damaging Het
Lrriq1 C T 10: 103,051,634 (GRCm39) E373K probably damaging Het
Map6 G A 7: 98,986,043 (GRCm39) G649D probably benign Het
Mccc1 A G 3: 36,044,196 (GRCm39) probably null Het
Mical3 A T 6: 120,934,683 (GRCm39) S1799T probably benign Het
Mmp23 T A 4: 155,736,589 (GRCm39) T151S probably damaging Het
Myo1d T A 11: 80,565,534 (GRCm39) N401I probably damaging Het
Myo9b T A 8: 71,774,457 (GRCm39) S323T probably damaging Het
Nbn G T 4: 15,979,353 (GRCm39) W446L probably benign Het
Nedd1 A T 10: 92,552,127 (GRCm39) probably benign Het
Ngef C A 1: 87,415,684 (GRCm39) probably benign Het
Nup153 A T 13: 46,847,412 (GRCm39) N672K probably benign Het
Or10d1b T A 9: 39,613,469 (GRCm39) I199F probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or4e2 T C 14: 52,687,969 (GRCm39) V33A probably benign Het
Or4f57 T C 2: 111,791,361 (GRCm39) N19S probably benign Het
Pakap T G 4: 57,710,177 (GRCm39) V374G possibly damaging Het
Pdlim3 C A 8: 46,361,497 (GRCm39) probably benign Het
Pmfbp1 G A 8: 110,268,305 (GRCm39) E951K probably damaging Het
Pop1 T A 15: 34,516,037 (GRCm39) C548* probably null Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Ptpdc1 A T 13: 48,739,456 (GRCm39) N658K probably benign Het
Ptprk A C 10: 28,082,221 (GRCm39) E63D possibly damaging Het
Rtf1 C T 2: 119,563,358 (GRCm39) R712W probably damaging Het
Samd7 A C 3: 30,805,222 (GRCm39) T2P probably benign Het
Sft2d1 A G 17: 8,538,254 (GRCm39) T52A probably benign Het
Slc25a26 A G 6: 94,487,814 (GRCm39) H91R probably damaging Het
Slc5a4a A G 10: 76,024,986 (GRCm39) E621G possibly damaging Het
Slf1 A T 13: 77,274,751 (GRCm39) L28* probably null Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Sorcs2 G A 5: 36,554,897 (GRCm39) probably benign Het
Tacc2 T C 7: 130,353,555 (GRCm39) probably benign Het
Tas2r140 A G 6: 133,032,290 (GRCm39) V156A possibly damaging Het
Terf2ip C A 8: 112,744,796 (GRCm39) T371K possibly damaging Het
Tifa C T 3: 127,590,537 (GRCm39) L103F probably damaging Het
Tmco3 A G 8: 13,342,037 (GRCm39) N104D probably damaging Het
Tmem259 T A 10: 79,814,797 (GRCm39) D240V probably damaging Het
Trim60 C T 8: 65,453,700 (GRCm39) R183H probably benign Het
Trps1 T C 15: 50,528,139 (GRCm39) N725D probably damaging Het
Ttn C T 2: 76,645,150 (GRCm39) V12902M probably damaging Het
Ubxn4 G A 1: 128,190,641 (GRCm39) E256K probably benign Het
Unc79 A G 12: 103,079,150 (GRCm39) K1772E probably damaging Het
Vwde C T 6: 13,193,125 (GRCm39) V405I probably benign Het
Wdr18 T A 10: 79,802,242 (GRCm39) D290E probably damaging Het
Wwc2 G A 8: 48,353,756 (GRCm39) A126V probably benign Het
Zfp882 A T 8: 72,667,367 (GRCm39) I105F possibly damaging Het
Zfp942 A T 17: 22,147,553 (GRCm39) C359S probably benign Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126,353,610 (GRCm39) missense probably damaging 0.98
IGL02578:Ago1 APN 4 126,333,324 (GRCm39) missense probably benign 0.12
IGL02709:Ago1 APN 4 126,347,433 (GRCm39) nonsense probably null
IGL02810:Ago1 APN 4 126,336,886 (GRCm39) missense probably benign 0.00
IGL03037:Ago1 APN 4 126,355,587 (GRCm39) missense probably benign 0.00
IGL03091:Ago1 APN 4 126,352,982 (GRCm39) missense probably damaging 0.98
IGL03100:Ago1 APN 4 126,336,964 (GRCm39) missense probably benign 0.08
IGL03121:Ago1 APN 4 126,353,796 (GRCm39) missense probably benign 0.00
R0195:Ago1 UTSW 4 126,357,484 (GRCm39) missense probably benign 0.01
R0309:Ago1 UTSW 4 126,336,959 (GRCm39) missense probably benign 0.06
R0514:Ago1 UTSW 4 126,333,388 (GRCm39) missense probably benign
R0557:Ago1 UTSW 4 126,353,817 (GRCm39) missense probably benign 0.00
R1104:Ago1 UTSW 4 126,347,426 (GRCm39) missense probably damaging 0.99
R1553:Ago1 UTSW 4 126,334,194 (GRCm39) missense probably damaging 0.99
R1624:Ago1 UTSW 4 126,357,534 (GRCm39) missense probably damaging 0.97
R1851:Ago1 UTSW 4 126,333,788 (GRCm39) missense probably benign 0.00
R1867:Ago1 UTSW 4 126,335,029 (GRCm39) missense probably damaging 0.98
R2001:Ago1 UTSW 4 126,348,187 (GRCm39) missense probably null 0.36
R2051:Ago1 UTSW 4 126,354,246 (GRCm39) missense probably benign 0.01
R2057:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R2105:Ago1 UTSW 4 126,355,581 (GRCm39) missense probably benign 0.30
R2117:Ago1 UTSW 4 126,357,650 (GRCm39) splice site probably null
R2256:Ago1 UTSW 4 126,335,704 (GRCm39) missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126,347,443 (GRCm39) missense probably benign 0.01
R2517:Ago1 UTSW 4 126,333,732 (GRCm39) nonsense probably null
R2850:Ago1 UTSW 4 126,336,868 (GRCm39) splice site probably benign
R2993:Ago1 UTSW 4 126,333,839 (GRCm39) splice site probably benign
R3746:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R3747:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R3750:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R4600:Ago1 UTSW 4 126,354,185 (GRCm39) missense probably benign 0.37
R4934:Ago1 UTSW 4 126,342,652 (GRCm39) missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126,347,447 (GRCm39) missense probably damaging 0.99
R5086:Ago1 UTSW 4 126,347,397 (GRCm39) missense probably benign 0.01
R5132:Ago1 UTSW 4 126,355,516 (GRCm39) missense probably benign 0.01
R5239:Ago1 UTSW 4 126,335,008 (GRCm39) missense probably damaging 1.00
R5609:Ago1 UTSW 4 126,354,830 (GRCm39) missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126,342,587 (GRCm39) missense probably benign 0.01
R5980:Ago1 UTSW 4 126,354,362 (GRCm39) unclassified probably benign
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6398:Ago1 UTSW 4 126,342,601 (GRCm39) missense probably benign 0.26
R6505:Ago1 UTSW 4 126,357,628 (GRCm39) missense probably benign 0.00
R6545:Ago1 UTSW 4 126,348,145 (GRCm39) missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126,354,215 (GRCm39) missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126,357,499 (GRCm39) missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126,333,298 (GRCm39) makesense probably null
R7496:Ago1 UTSW 4 126,355,545 (GRCm39) missense probably benign 0.20
R7575:Ago1 UTSW 4 126,347,701 (GRCm39) missense probably benign 0.12
R7625:Ago1 UTSW 4 126,337,022 (GRCm39) missense probably benign 0.18
R7988:Ago1 UTSW 4 126,354,210 (GRCm39) missense probably damaging 1.00
R8041:Ago1 UTSW 4 126,335,729 (GRCm39) missense probably damaging 1.00
R8073:Ago1 UTSW 4 126,337,019 (GRCm39) missense probably benign 0.04
R8086:Ago1 UTSW 4 126,354,774 (GRCm39) missense probably benign
R8127:Ago1 UTSW 4 126,348,214 (GRCm39) missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126,354,316 (GRCm39) unclassified probably benign
R8878:Ago1 UTSW 4 126,357,516 (GRCm39) missense probably benign 0.35
R8989:Ago1 UTSW 4 126,357,583 (GRCm39) missense probably benign 0.01
R9140:Ago1 UTSW 4 126,336,977 (GRCm39) missense probably benign
X0025:Ago1 UTSW 4 126,336,908 (GRCm39) missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126,347,449 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCTGTGCTCATGCACATCAG -3'
(R):5'- AGAATAGGACCTTCTCCATCTGCCAG -3'

Sequencing Primer
(F):5'- GCAAATATTAGACTATGCTCCGTGC -3'
(R):5'- CCGGTAGAGACAGTTATCTCAGTC -3'
Posted On 2013-05-23