Incidental Mutation 'R4911:Dnah2'
ID379562
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Namedynein, axonemal, heavy chain 2
SynonymsDnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission 042513-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4911 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69420809-69549110 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 69499104 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
Predicted Effect probably null
Transcript: ENSMUST00000035539
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108659
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (149/153)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 132 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,170,939 probably null Het
4430402I18Rik G A 19: 28,897,503 probably benign Het
Aacs A G 5: 125,506,160 D260G possibly damaging Het
Aadacl4 T A 4: 144,613,792 L29H probably damaging Het
Abca7 T C 10: 80,012,188 probably null Het
Adgre1 G A 17: 57,447,832 M643I possibly damaging Het
Adgrl2 A T 3: 148,890,463 M79K probably damaging Het
Ankrd55 T A 13: 112,323,039 probably null Het
Arhgap21 A G 2: 20,858,989 I1257T probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgap39 A G 15: 76,737,805 S199P probably damaging Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Atp7a T C X: 106,120,374 V1305A probably damaging Het
B3gnt3 T A 8: 71,692,934 R263S probably benign Het
B9d1 A C 11: 61,507,671 D59A probably benign Het
Bag2 A T 1: 33,748,276 I55N probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bbs2 A T 8: 94,089,115 D174E probably damaging Het
Bmp8b T C 4: 123,115,237 W203R probably damaging Het
Cacnb2 A T 2: 14,981,340 E359D possibly damaging Het
Camp T A 9: 109,847,583 probably null Het
Casp4 C T 9: 5,328,580 probably benign Het
Ccdc110 A T 8: 45,942,907 T612S probably benign Het
Cd209b T A 8: 3,926,640 probably null Het
Cemip T C 7: 83,983,253 D367G probably damaging Het
Cers5 T A 15: 99,747,079 N131I probably damaging Het
Chd5 T G 4: 152,360,672 V370G probably damaging Het
Cipc C A 12: 86,952,757 Q20K probably benign Het
Cnr2 T A 4: 135,917,201 F197I possibly damaging Het
Col7a1 G A 9: 108,975,219 G2233S unknown Het
Dcdc2b T A 4: 129,611,267 I125F possibly damaging Het
Ddi2 A G 4: 141,684,402 S400P probably benign Het
Ddx31 C A 2: 28,904,684 T664K probably benign Het
Dhx30 C A 9: 110,100,924 G35C probably damaging Het
Dmxl2 G A 9: 54,411,653 T1576I probably damaging Het
Dnah1 T C 14: 31,295,323 Y1510C probably damaging Het
Dock10 C A 1: 80,606,236 G163C probably damaging Het
Edar T C 10: 58,621,324 N144S probably benign Het
Elavl2 T A 4: 91,308,678 E54D possibly damaging Het
Enam T G 5: 88,502,314 S561A probably benign Het
Ercc5 C A 1: 44,166,871 H315N possibly damaging Het
Esp31 A G 17: 38,644,661 E65G possibly damaging Het
Faap100 T C 11: 120,372,113 I806M probably benign Het
Fam159a T C 4: 108,377,461 T70A probably benign Het
Fbxw21 T C 9: 109,145,663 Y263C probably damaging Het
Fsip2 T A 2: 82,981,493 S2719T possibly damaging Het
Fv1 T C 4: 147,869,418 V147A probably benign Het
Gal T C 19: 3,411,590 E65G probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Gcc2 A G 10: 58,270,439 E399G probably damaging Het
Gfi1b A T 2: 28,610,102 C306S probably damaging Het
Gm10654 T A 8: 70,931,852 noncoding transcript Het
Gm20388 A G 8: 123,080,604 probably benign Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gorasp2 T C 2: 70,688,339 probably benign Het
Gse1 T C 8: 120,568,466 probably benign Het
H2-D1 A G 17: 35,265,997 E278G probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hgs T A 11: 120,477,202 S246T probably damaging Het
Hs2st1 T C 3: 144,465,082 T110A probably benign Het
Hydin A G 8: 110,595,438 Y4574C probably benign Het
Ighv1-23 C A 12: 114,764,752 V17F possibly damaging Het
Ighv8-14 A T 12: 115,808,565 noncoding transcript Het
Igsf21 C T 4: 140,034,623 R248H probably benign Het
Il23r T C 6: 67,423,561 N595S probably benign Het
Il5ra G T 6: 106,715,668 P372Q probably damaging Het
Iltifb T C 10: 118,294,989 M1V probably null Het
Inppl1 A G 7: 101,832,309 V222A possibly damaging Het
Ints10 T C 8: 68,827,312 V697A probably damaging Het
Isg15 T A 4: 156,199,760 T104S probably benign Het
Kif11 A G 19: 37,417,937 T983A probably benign Het
Kif3b A T 2: 153,317,292 K338* probably null Het
Kpna2 T A 11: 106,990,719 I362F probably damaging Het
Lama2 G A 10: 27,138,927 T1595M probably damaging Het
Lrrc36 A G 8: 105,426,935 T126A probably benign Het
Lrrk1 T A 7: 66,295,454 D604V probably damaging Het
Map7d1 T C 4: 126,236,691 K409E probably damaging Het
Mast2 T C 4: 116,353,057 T110A probably benign Het
Micall2 G A 5: 139,716,825 T221M probably damaging Het
Morc2b T A 17: 33,137,377 N474Y probably damaging Het
Myo1e T A 9: 70,343,096 M528K probably benign Het
Nlrp1c-ps G T 11: 71,260,369 noncoding transcript Het
Nostrin T C 2: 69,161,142 S160P possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Olfr452 T A 6: 42,790,204 L55H probably damaging Het
Olfr488 T C 7: 108,256,037 I34V possibly damaging Het
Olfr894 A G 9: 38,219,096 E91G probably damaging Het
Pabpc4l A T 3: 46,446,162 M349K possibly damaging Het
Pah G A 10: 87,570,267 G256S probably benign Het
Park2 G T 17: 10,840,472 probably benign Het
Pigk T C 3: 152,740,204 S151P probably damaging Het
Plcd4 A C 1: 74,564,413 T658P possibly damaging Het
Pld4 A T 12: 112,764,517 S178C probably benign Het
Polr1a G A 6: 71,909,229 E23K possibly damaging Het
Pomt1 T C 2: 32,241,679 S127P probably damaging Het
Pon2 A G 6: 5,269,029 V215A possibly damaging Het
Ppp3cb A T 14: 20,509,440 M416K probably damaging Het
Prdm1 A T 10: 44,442,052 N273K possibly damaging Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptch1 G A 13: 63,523,052 T888M probably damaging Het
Pusl1 T G 4: 155,891,442 probably benign Het
Rapgef6 A T 11: 54,622,317 E122D probably damaging Het
Rif1 C T 2: 52,110,518 T1328I probably damaging Het
Rngtt T G 4: 33,500,292 probably null Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd1 A G 8: 83,998,989 probably benign Het
Scamp5 A T 9: 57,451,452 F14I probably damaging Het
Shank3 C T 15: 89,504,344 R380C probably damaging Het
Slc1a4 C A 11: 20,332,166 A103S probably damaging Het
Slc39a14 A G 14: 70,309,922 V325A probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Synpo C T 18: 60,629,864 probably benign Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tacc1 A G 8: 25,182,606 M111T possibly damaging Het
Tec T C 5: 72,756,351 D613G probably benign Het
Tecpr2 C T 12: 110,931,487 T391I possibly damaging Het
Thop1 G A 10: 81,073,291 G52D probably damaging Het
Tmco5 T A 2: 116,892,208 V270D possibly damaging Het
Ttn C T 2: 76,726,629 E28265K possibly damaging Het
Tuft1 T C 3: 94,635,443 D72G probably damaging Het
Tyrp1 C T 4: 80,850,907 probably benign Het
Usp9y T C Y: 1,308,041 D2265G probably damaging Het
Vmn2r104 G A 17: 20,030,026 A661V probably benign Het
Vwa5a A T 9: 38,737,972 N672I probably benign Het
Wdr95 A T 5: 149,611,692 K772* probably null Het
Ybx1 T C 4: 119,282,813 T106A probably benign Het
Ypel3 T C 7: 126,777,789 S14P probably benign Het
Zfp518a T A 19: 40,915,528 S1300R probably benign Het
Zscan5b A T 7: 6,239,190 *469Y probably null Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69459201 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69477683 missense probably benign 0.07
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 intron probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69465376 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4740:Dnah2 UTSW 11 69458042 missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7073:Dnah2 UTSW 11 69430492 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 utr 5 prime probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69478797 missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7615:Dnah2 UTSW 11 69435304 missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69498685 missense probably damaging 0.99
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACAAGACATCGGGATCAATTC -3'
(R):5'- TAGGAGCCTGCCAAGTTTCC -3'

Sequencing Primer
(F):5'- AGACATCGGGATCAATTCCTAAC -3'
(R):5'- AAGTTTCCTGGCACGAGG -3'
Posted On2016-04-15