Incidental Mutation 'R4911:Ptch1'
ID 379572
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Name patched 1
Synonyms wig, Ptc, Ptc1, A230106A15Rik, Patched 1
MMRRC Submission 042513-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4911 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 63656142-63721274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 63670866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 888 (T888M)
Ref Sequence ENSEMBL: ENSMUSP00000141489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]
AlphaFold Q61115
Predicted Effect probably damaging
Transcript: ENSMUST00000021921
AA Change: T1025M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: T1025M

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192155
AA Change: T888M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: T888M

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194663
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195258
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (149/153)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 132 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs A G 5: 125,583,224 (GRCm39) D260G possibly damaging Het
Aadacl4 T A 4: 144,340,362 (GRCm39) L29H probably damaging Het
Abca7 T C 10: 79,848,022 (GRCm39) probably null Het
Adgre1 G A 17: 57,754,832 (GRCm39) M643I possibly damaging Het
Adgrl2 A T 3: 148,596,099 (GRCm39) M79K probably damaging Het
Ankrd55 T A 13: 112,459,573 (GRCm39) probably null Het
Aopep A T 13: 63,318,753 (GRCm39) probably null Het
Arhgap21 A G 2: 20,863,800 (GRCm39) I1257T probably damaging Het
Arhgap26 T A 18: 39,126,690 (GRCm39) probably benign Het
Arhgap39 A G 15: 76,622,005 (GRCm39) S199P probably damaging Het
Arhgef5 A G 6: 43,249,762 (GRCm39) D171G probably benign Het
Atp7a T C X: 105,163,980 (GRCm39) V1305A probably damaging Het
B3gnt3 T A 8: 72,145,578 (GRCm39) R263S probably benign Het
B9d1 A C 11: 61,398,497 (GRCm39) D59A probably benign Het
Bag2 A T 1: 33,787,357 (GRCm39) I55N probably benign Het
Bank1 T C 3: 135,990,004 (GRCm39) I29V probably benign Het
Bbs2 A T 8: 94,815,743 (GRCm39) D174E probably damaging Het
Bmp8b T C 4: 123,009,030 (GRCm39) W203R probably damaging Het
Cacnb2 A T 2: 14,986,151 (GRCm39) E359D possibly damaging Het
Camp T A 9: 109,676,651 (GRCm39) probably null Het
Casp4 C T 9: 5,328,580 (GRCm39) probably benign Het
Ccdc110 A T 8: 46,395,944 (GRCm39) T612S probably benign Het
Cd209b T A 8: 3,976,640 (GRCm39) probably null Het
Cemip T C 7: 83,632,461 (GRCm39) D367G probably damaging Het
Cers5 T A 15: 99,644,960 (GRCm39) N131I probably damaging Het
Cfhr4 T G 1: 139,702,301 (GRCm39) D61A probably damaging Het
Chd5 T G 4: 152,445,129 (GRCm39) V370G probably damaging Het
Cipc C A 12: 86,999,531 (GRCm39) Q20K probably benign Het
Cnr2 T A 4: 135,644,512 (GRCm39) F197I possibly damaging Het
Col7a1 G A 9: 108,804,287 (GRCm39) G2233S unknown Het
Dcdc2b T A 4: 129,505,060 (GRCm39) I125F possibly damaging Het
Ddi2 A G 4: 141,411,713 (GRCm39) S400P probably benign Het
Ddx31 C A 2: 28,794,696 (GRCm39) T664K probably benign Het
Dhx30 C A 9: 109,929,992 (GRCm39) G35C probably damaging Het
Dmxl2 G A 9: 54,318,937 (GRCm39) T1576I probably damaging Het
Dnah1 T C 14: 31,017,280 (GRCm39) Y1510C probably damaging Het
Dnah2 C T 11: 69,389,930 (GRCm39) probably null Het
Dock10 C A 1: 80,583,953 (GRCm39) G163C probably damaging Het
Edar T C 10: 58,457,146 (GRCm39) N144S probably benign Het
Elavl2 T A 4: 91,196,915 (GRCm39) E54D possibly damaging Het
Enam T G 5: 88,650,173 (GRCm39) S561A probably benign Het
Ercc5 C A 1: 44,206,031 (GRCm39) H315N possibly damaging Het
Esp31 A G 17: 38,955,552 (GRCm39) E65G possibly damaging Het
Faap100 T C 11: 120,262,939 (GRCm39) I806M probably benign Het
Fbxw21 T C 9: 108,974,731 (GRCm39) Y263C probably damaging Het
Fsip2 T A 2: 82,811,837 (GRCm39) S2719T possibly damaging Het
Fv1 T C 4: 147,953,875 (GRCm39) V147A probably benign Het
Gal T C 19: 3,461,590 (GRCm39) E65G probably benign Het
Galnt2l A G 8: 123,807,343 (GRCm39) probably benign Het
Galnt6 T C 15: 100,614,059 (GRCm39) T81A probably benign Het
Gcc2 A G 10: 58,106,261 (GRCm39) E399G probably damaging Het
Gfi1b A T 2: 28,500,114 (GRCm39) C306S probably damaging Het
Gm10654 T A 8: 71,384,496 (GRCm39) noncoding transcript Het
Gm4953 T A 1: 158,995,929 (GRCm39) noncoding transcript Het
Gorasp2 T C 2: 70,518,683 (GRCm39) probably benign Het
Gse1 T C 8: 121,295,205 (GRCm39) probably benign Het
H2-D1 A G 17: 35,484,973 (GRCm39) E278G probably damaging Het
Herc2 T C 7: 55,877,640 (GRCm39) L4569P probably damaging Het
Hgs T A 11: 120,368,028 (GRCm39) S246T probably damaging Het
Hs2st1 T C 3: 144,170,843 (GRCm39) T110A probably benign Het
Hydin A G 8: 111,322,070 (GRCm39) Y4574C probably benign Het
Ighv1-23 C A 12: 114,728,372 (GRCm39) V17F possibly damaging Het
Ighv8-14 A T 12: 115,772,185 (GRCm39) noncoding transcript Het
Igsf21 C T 4: 139,761,934 (GRCm39) R248H probably benign Het
Il22b T C 10: 118,130,894 (GRCm39) M1V probably null Het
Il23r T C 6: 67,400,545 (GRCm39) N595S probably benign Het
Il5ra G T 6: 106,692,629 (GRCm39) P372Q probably damaging Het
Inppl1 A G 7: 101,481,516 (GRCm39) V222A possibly damaging Het
Ints10 T C 8: 69,279,964 (GRCm39) V697A probably damaging Het
Isg15 T A 4: 156,284,217 (GRCm39) T104S probably benign Het
Kif11 A G 19: 37,406,385 (GRCm39) T983A probably benign Het
Kif3b A T 2: 153,159,212 (GRCm39) K338* probably null Het
Kpna2 T A 11: 106,881,545 (GRCm39) I362F probably damaging Het
Lama2 G A 10: 27,014,923 (GRCm39) T1595M probably damaging Het
Lrrc36 A G 8: 106,153,567 (GRCm39) T126A probably benign Het
Lrrk1 T A 7: 65,945,202 (GRCm39) D604V probably damaging Het
Map7d1 T C 4: 126,130,484 (GRCm39) K409E probably damaging Het
Mast2 T C 4: 116,210,254 (GRCm39) T110A probably benign Het
Micall2 G A 5: 139,702,580 (GRCm39) T221M probably damaging Het
Morc2b T A 17: 33,356,351 (GRCm39) N474Y probably damaging Het
Myo1e T A 9: 70,250,378 (GRCm39) M528K probably benign Het
Nlrp1c-ps G T 11: 71,151,195 (GRCm39) noncoding transcript Het
Nostrin T C 2: 68,991,486 (GRCm39) S160P possibly damaging Het
Nup133 T C 8: 124,653,870 (GRCm39) R530G possibly damaging Het
Or2f2 T A 6: 42,767,138 (GRCm39) L55H probably damaging Het
Or5p64 T C 7: 107,855,244 (GRCm39) I34V possibly damaging Het
Or8c16 A G 9: 38,130,392 (GRCm39) E91G probably damaging Het
Pabpc4l A T 3: 46,400,597 (GRCm39) M349K possibly damaging Het
Pah G A 10: 87,406,129 (GRCm39) G256S probably benign Het
Pigk T C 3: 152,445,841 (GRCm39) S151P probably damaging Het
Plcd4 A C 1: 74,603,572 (GRCm39) T658P possibly damaging Het
Pld4 A T 12: 112,730,951 (GRCm39) S178C probably benign Het
Polr1a G A 6: 71,886,213 (GRCm39) E23K possibly damaging Het
Pomt1 T C 2: 32,131,691 (GRCm39) S127P probably damaging Het
Pon2 A G 6: 5,269,029 (GRCm39) V215A possibly damaging Het
Ppp3cb A T 14: 20,559,508 (GRCm39) M416K probably damaging Het
Prdm1 A T 10: 44,318,048 (GRCm39) N273K possibly damaging Het
Prg4 T A 1: 150,331,574 (GRCm39) probably benign Het
Prkn G T 17: 11,059,359 (GRCm39) probably benign Het
Pusl1 T G 4: 155,975,899 (GRCm39) probably benign Het
Rapgef6 A T 11: 54,513,143 (GRCm39) E122D probably damaging Het
Rif1 C T 2: 52,000,530 (GRCm39) T1328I probably damaging Het
Rngtt T G 4: 33,500,292 (GRCm39) probably null Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Samd1 A G 8: 84,725,618 (GRCm39) probably benign Het
Scamp5 A T 9: 57,358,735 (GRCm39) F14I probably damaging Het
Shank3 C T 15: 89,388,547 (GRCm39) R380C probably damaging Het
Shisal2a T C 4: 108,234,658 (GRCm39) T70A probably benign Het
Slc1a4 C A 11: 20,282,166 (GRCm39) A103S probably damaging Het
Slc39a14 A G 14: 70,547,371 (GRCm39) V325A probably benign Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Spata6l G A 19: 28,874,903 (GRCm39) probably benign Het
Spta1 T A 1: 174,013,213 (GRCm39) S375T probably damaging Het
Sval1 A G 6: 41,932,378 (GRCm39) N76S probably benign Het
Synpo C T 18: 60,762,936 (GRCm39) probably benign Het
Sytl5 C T X: 9,781,841 (GRCm39) P181L possibly damaging Het
Tacc1 A G 8: 25,672,622 (GRCm39) M111T possibly damaging Het
Tec T C 5: 72,913,694 (GRCm39) D613G probably benign Het
Tecpr2 C T 12: 110,897,921 (GRCm39) T391I possibly damaging Het
Thop1 G A 10: 80,909,125 (GRCm39) G52D probably damaging Het
Tmco5 T A 2: 116,722,689 (GRCm39) V270D possibly damaging Het
Ttn C T 2: 76,556,973 (GRCm39) E28265K possibly damaging Het
Tuft1 T C 3: 94,542,750 (GRCm39) D72G probably damaging Het
Tyrp1 C T 4: 80,769,144 (GRCm39) probably benign Het
Usp9y T C Y: 1,308,041 (GRCm39) D2265G probably damaging Het
Vmn2r104 G A 17: 20,250,288 (GRCm39) A661V probably benign Het
Vwa5a A T 9: 38,649,268 (GRCm39) N672I probably benign Het
Wdr95 A T 5: 149,535,157 (GRCm39) K772* probably null Het
Ybx1 T C 4: 119,140,010 (GRCm39) T106A probably benign Het
Ypel3 T C 7: 126,376,961 (GRCm39) S14P probably benign Het
Zfp518a T A 19: 40,903,972 (GRCm39) S1300R probably benign Het
Zscan5b A T 7: 6,242,189 (GRCm39) *469Y probably null Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63,674,989 (GRCm39) missense probably benign 0.00
IGL01084:Ptch1 APN 13 63,691,451 (GRCm39) missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63,659,495 (GRCm39) missense probably benign
IGL02260:Ptch1 APN 13 63,713,166 (GRCm39) unclassified probably benign
IGL02439:Ptch1 APN 13 63,692,910 (GRCm39) missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63,659,732 (GRCm39) missense probably benign 0.13
IGL02797:Ptch1 APN 13 63,681,421 (GRCm39) missense probably benign
R0463:Ptch1 UTSW 13 63,668,121 (GRCm39) missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63,691,294 (GRCm39) splice site probably benign
R0657:Ptch1 UTSW 13 63,661,565 (GRCm39) missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63,687,657 (GRCm39) missense probably benign 0.23
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1539:Ptch1 UTSW 13 63,689,101 (GRCm39) missense probably benign 0.00
R1616:Ptch1 UTSW 13 63,687,656 (GRCm39) missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63,659,841 (GRCm39) nonsense probably null
R1985:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R1986:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2024:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2025:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2026:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2027:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2096:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2097:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2100:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2105:Ptch1 UTSW 13 63,693,059 (GRCm39) missense probably benign
R2165:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2166:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2167:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2168:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2226:Ptch1 UTSW 13 63,661,485 (GRCm39) missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2504:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2507:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2696:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2698:Ptch1 UTSW 13 63,690,038 (GRCm39) missense probably damaging 1.00
R2698:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2971:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3410:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3708:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3744:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3745:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3783:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3784:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3785:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3807:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3950:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4013:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4015:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4016:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4017:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4035:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4083:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4084:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4179:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63,691,422 (GRCm39) missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63,670,978 (GRCm39) missense probably benign 0.02
R4809:Ptch1 UTSW 13 63,661,522 (GRCm39) missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63,670,818 (GRCm39) missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63,672,884 (GRCm39) missense probably benign 0.02
R5386:Ptch1 UTSW 13 63,692,857 (GRCm39) missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63,675,059 (GRCm39) missense probably benign
R5604:Ptch1 UTSW 13 63,672,936 (GRCm39) missense probably benign 0.01
R5846:Ptch1 UTSW 13 63,713,268 (GRCm39) unclassified probably benign
R5926:Ptch1 UTSW 13 63,692,869 (GRCm39) missense probably benign 0.01
R5945:Ptch1 UTSW 13 63,721,233 (GRCm39) utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63,672,929 (GRCm39) missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63,691,359 (GRCm39) missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63,661,503 (GRCm39) missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63,691,422 (GRCm39) missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63,670,918 (GRCm39) missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63,687,644 (GRCm39) missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63,672,881 (GRCm39) missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63,659,550 (GRCm39) missense probably benign 0.23
R7168:Ptch1 UTSW 13 63,659,874 (GRCm39) missense probably benign
R7257:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7258:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7259:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7368:Ptch1 UTSW 13 63,659,798 (GRCm39) missense probably benign 0.06
R7525:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7528:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7820:Ptch1 UTSW 13 63,670,875 (GRCm39) missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63,688,626 (GRCm39) missense probably damaging 0.98
R8373:Ptch1 UTSW 13 63,688,982 (GRCm39) missense probably damaging 1.00
R8398:Ptch1 UTSW 13 63,672,939 (GRCm39) missense probably benign 0.06
R8407:Ptch1 UTSW 13 63,662,057 (GRCm39) missense probably null 1.00
R8839:Ptch1 UTSW 13 63,689,038 (GRCm39) missense probably damaging 1.00
R9075:Ptch1 UTSW 13 63,681,335 (GRCm39) missense possibly damaging 0.87
R9476:Ptch1 UTSW 13 63,681,448 (GRCm39) missense probably benign 0.05
R9514:Ptch1 UTSW 13 63,675,071 (GRCm39) missense probably benign
R9528:Ptch1 UTSW 13 63,661,615 (GRCm39) missense probably benign 0.00
R9568:Ptch1 UTSW 13 63,689,987 (GRCm39) missense probably damaging 0.99
Z1177:Ptch1 UTSW 13 63,668,093 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTCTGGCGTTAGAAGGATCC -3'
(R):5'- ACCTCAGACTTTGTGGAAGC -3'

Sequencing Primer
(F):5'- TGGCGTTAGAAGGATCCCCATG -3'
(R):5'- CCTCAGACTTTGTGGAAGCCATAG -3'
Posted On 2016-04-15