Mutagenetix > Incidental Mutation

Incidental Mutation 'R4911:Ptch1'

379572

Institutional Source

Beutler Lab

Gene Symbol

Ptch1

Ensembl Gene

ENSMUSG00000021466

Gene Name

patched 1

Synonyms

A230106A15Rik, Patched 1, Ptc1, Ptc

MMRRC Submission

042513-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4911 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63508328-63573598 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 63523052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 888 (T888M)

Ref Sequence

ENSEMBL: ENSMUSP00000141489 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]

AlphaFold

Q61115

Predicted Effect

probably damaging
Transcript: ENSMUST00000021921
AA Change: T1025M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: T1025M

Domain	Start	End	E-Value	Type
low complexity region	4	30	N/A	INTRINSIC
Pfam:Patched	351	871	7.6e-47	PFAM
Pfam:Sterol-sensing	448	602	1.5e-45	PFAM
Pfam:Patched	952	1166	9.8e-33	PFAM
low complexity region	1180	1189	N/A	INTRINSIC
low complexity region	1204	1213	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1355	1367	N/A	INTRINSIC
low complexity region	1369	1384	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192155
AA Change: T888M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: T888M

Domain	Start	End	E-Value	Type
Pfam:Patched	214	733	3.1e-44	PFAM
Pfam:Sterol-sensing	311	465	2.8e-46	PFAM
Pfam:Patched	814	1029	3.1e-30	PFAM
low complexity region	1043	1052	N/A	INTRINSIC
low complexity region	1067	1076	N/A	INTRINSIC
low complexity region	1144	1159	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1232	1247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194663

SMART Domains

Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	298	569	4.7e-34	PFAM
Pfam:Sterol-sensing	396	550	7.9e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195258

SMART Domains

Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	212	426	7.8e-28	PFAM
Pfam:Sterol-sensing	311	426	8e-33	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (149/153)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 132 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	T	13: 63,170,939		probably null	Het
4430402I18Rik	G	A	19: 28,897,503		probably benign	Het
Aacs	A	G	5: 125,506,160	D260G	possibly damaging	Het
Aadacl4	T	A	4: 144,613,792	L29H	probably damaging	Het
Abca7	T	C	10: 80,012,188		probably null	Het
Adgre1	G	A	17: 57,447,832	M643I	possibly damaging	Het
Adgrl2	A	T	3: 148,890,463	M79K	probably damaging	Het
Ankrd55	T	A	13: 112,323,039		probably null	Het
Arhgap21	A	G	2: 20,858,989	I1257T	probably damaging	Het
Arhgap26	T	A	18: 38,993,637		probably benign	Het
Arhgap39	A	G	15: 76,737,805	S199P	probably damaging	Het
Arhgef5	A	G	6: 43,272,828	D171G	probably benign	Het
Atp7a	T	C	X: 106,120,374	V1305A	probably damaging	Het
B3gnt3	T	A	8: 71,692,934	R263S	probably benign	Het
B9d1	A	C	11: 61,507,671	D59A	probably benign	Het
Bag2	A	T	1: 33,748,276	I55N	probably benign	Het
Bank1	T	C	3: 136,284,243	I29V	probably benign	Het
Bbs2	A	T	8: 94,089,115	D174E	probably damaging	Het
Bmp8b	T	C	4: 123,115,237	W203R	probably damaging	Het
Cacnb2	A	T	2: 14,981,340	E359D	possibly damaging	Het
Camp	T	A	9: 109,847,583		probably null	Het
Casp4	C	T	9: 5,328,580		probably benign	Het
Ccdc110	A	T	8: 45,942,907	T612S	probably benign	Het
Cd209b	T	A	8: 3,926,640		probably null	Het
Cemip	T	C	7: 83,983,253	D367G	probably damaging	Het
Cers5	T	A	15: 99,747,079	N131I	probably damaging	Het
Chd5	T	G	4: 152,360,672	V370G	probably damaging	Het
Cipc	C	A	12: 86,952,757	Q20K	probably benign	Het
Cnr2	T	A	4: 135,917,201	F197I	possibly damaging	Het
Col7a1	G	A	9: 108,975,219	G2233S	unknown	Het
Dcdc2b	T	A	4: 129,611,267	I125F	possibly damaging	Het
Ddi2	A	G	4: 141,684,402	S400P	probably benign	Het
Ddx31	C	A	2: 28,904,684	T664K	probably benign	Het
Dhx30	C	A	9: 110,100,924	G35C	probably damaging	Het
Dmxl2	G	A	9: 54,411,653	T1576I	probably damaging	Het
Dnah1	T	C	14: 31,295,323	Y1510C	probably damaging	Het
Dnah2	C	T	11: 69,499,104		probably null	Het
Dock10	C	A	1: 80,606,236	G163C	probably damaging	Het
Edar	T	C	10: 58,621,324	N144S	probably benign	Het
Elavl2	T	A	4: 91,308,678	E54D	possibly damaging	Het
Enam	T	G	5: 88,502,314	S561A	probably benign	Het
Ercc5	C	A	1: 44,166,871	H315N	possibly damaging	Het
Esp31	A	G	17: 38,644,661	E65G	possibly damaging	Het
Faap100	T	C	11: 120,372,113	I806M	probably benign	Het
Fam159a	T	C	4: 108,377,461	T70A	probably benign	Het
Fbxw21	T	C	9: 109,145,663	Y263C	probably damaging	Het
Fsip2	T	A	2: 82,981,493	S2719T	possibly damaging	Het
Fv1	T	C	4: 147,869,418	V147A	probably benign	Het
Gal	T	C	19: 3,411,590	E65G	probably benign	Het
Galnt6	T	C	15: 100,716,178	T81A	probably benign	Het
Gcc2	A	G	10: 58,270,439	E399G	probably damaging	Het
Gfi1b	A	T	2: 28,610,102	C306S	probably damaging	Het
Gm10654	T	A	8: 70,931,852		noncoding transcript	Het
Gm20388	A	G	8: 123,080,604		probably benign	Het
Gm4788	T	G	1: 139,774,563	D61A	probably damaging	Het
Gm4953	T	A	1: 159,168,359		noncoding transcript	Het
Gorasp2	T	C	2: 70,688,339		probably benign	Het
Gse1	T	C	8: 120,568,466		probably benign	Het
H2-D1	A	G	17: 35,265,997	E278G	probably damaging	Het
Herc2	T	C	7: 56,227,892	L4569P	probably damaging	Het
Hgs	T	A	11: 120,477,202	S246T	probably damaging	Het
Hs2st1	T	C	3: 144,465,082	T110A	probably benign	Het
Hydin	A	G	8: 110,595,438	Y4574C	probably benign	Het
Ighv1-23	C	A	12: 114,764,752	V17F	possibly damaging	Het
Ighv8-14	A	T	12: 115,808,565		noncoding transcript	Het
Igsf21	C	T	4: 140,034,623	R248H	probably benign	Het
Il23r	T	C	6: 67,423,561	N595S	probably benign	Het
Il5ra	G	T	6: 106,715,668	P372Q	probably damaging	Het
Iltifb	T	C	10: 118,294,989	M1V	probably null	Het
Inppl1	A	G	7: 101,832,309	V222A	possibly damaging	Het
Ints10	T	C	8: 68,827,312	V697A	probably damaging	Het
Isg15	T	A	4: 156,199,760	T104S	probably benign	Het
Kif11	A	G	19: 37,417,937	T983A	probably benign	Het
Kif3b	A	T	2: 153,317,292	K338*	probably null	Het
Kpna2	T	A	11: 106,990,719	I362F	probably damaging	Het
Lama2	G	A	10: 27,138,927	T1595M	probably damaging	Het
Lrrc36	A	G	8: 105,426,935	T126A	probably benign	Het
Lrrk1	T	A	7: 66,295,454	D604V	probably damaging	Het
Map7d1	T	C	4: 126,236,691	K409E	probably damaging	Het
Mast2	T	C	4: 116,353,057	T110A	probably benign	Het
Micall2	G	A	5: 139,716,825	T221M	probably damaging	Het
Morc2b	T	A	17: 33,137,377	N474Y	probably damaging	Het
Myo1e	T	A	9: 70,343,096	M528K	probably benign	Het
Nlrp1c-ps	G	T	11: 71,260,369		noncoding transcript	Het
Nostrin	T	C	2: 69,161,142	S160P	possibly damaging	Het
Nup133	T	C	8: 123,927,131	R530G	possibly damaging	Het
Olfr452	T	A	6: 42,790,204	L55H	probably damaging	Het
Olfr488	T	C	7: 108,256,037	I34V	possibly damaging	Het
Olfr894	A	G	9: 38,219,096	E91G	probably damaging	Het
Pabpc4l	A	T	3: 46,446,162	M349K	possibly damaging	Het
Pah	G	A	10: 87,570,267	G256S	probably benign	Het
Park2	G	T	17: 10,840,472		probably benign	Het
Pigk	T	C	3: 152,740,204	S151P	probably damaging	Het
Plcd4	A	C	1: 74,564,413	T658P	possibly damaging	Het
Pld4	A	T	12: 112,764,517	S178C	probably benign	Het
Polr1a	G	A	6: 71,909,229	E23K	possibly damaging	Het
Pomt1	T	C	2: 32,241,679	S127P	probably damaging	Het
Pon2	A	G	6: 5,269,029	V215A	possibly damaging	Het
Ppp3cb	A	T	14: 20,509,440	M416K	probably damaging	Het
Prdm1	A	T	10: 44,442,052	N273K	possibly damaging	Het
Prg4	T	A	1: 150,455,823		probably benign	Het
Pusl1	T	G	4: 155,891,442		probably benign	Het
Rapgef6	A	T	11: 54,622,317	E122D	probably damaging	Het
Rif1	C	T	2: 52,110,518	T1328I	probably damaging	Het
Rngtt	T	G	4: 33,500,292		probably null	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Samd1	A	G	8: 83,998,989		probably benign	Het
Scamp5	A	T	9: 57,451,452	F14I	probably damaging	Het
Shank3	C	T	15: 89,504,344	R380C	probably damaging	Het
Slc1a4	C	A	11: 20,332,166	A103S	probably damaging	Het
Slc39a14	A	G	14: 70,309,922	V325A	probably benign	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Spta1	T	A	1: 174,185,647	S375T	probably damaging	Het
Sval1	A	G	6: 41,955,444	N76S	probably benign	Het
Synpo	C	T	18: 60,629,864		probably benign	Het
Sytl5	C	T	X: 9,915,602	P181L	possibly damaging	Het
Tacc1	A	G	8: 25,182,606	M111T	possibly damaging	Het
Tec	T	C	5: 72,756,351	D613G	probably benign	Het
Tecpr2	C	T	12: 110,931,487	T391I	possibly damaging	Het
Thop1	G	A	10: 81,073,291	G52D	probably damaging	Het
Tmco5	T	A	2: 116,892,208	V270D	possibly damaging	Het
Ttn	C	T	2: 76,726,629	E28265K	possibly damaging	Het
Tuft1	T	C	3: 94,635,443	D72G	probably damaging	Het
Tyrp1	C	T	4: 80,850,907		probably benign	Het
Usp9y	T	C	Y: 1,308,041	D2265G	probably damaging	Het
Vmn2r104	G	A	17: 20,030,026	A661V	probably benign	Het
Vwa5a	A	T	9: 38,737,972	N672I	probably benign	Het
Wdr95	A	T	5: 149,611,692	K772*	probably null	Het
Ybx1	T	C	4: 119,282,813	T106A	probably benign	Het
Ypel3	T	C	7: 126,777,789	S14P	probably benign	Het
Zfp518a	T	A	19: 40,915,528	S1300R	probably benign	Het
Zscan5b	A	T	7: 6,239,190	*469Y	probably null	Het

Other mutations in Ptch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Ptch1	APN	13	63527175	missense	probably benign	0.00
IGL01084:Ptch1	APN	13	63543637	missense	probably damaging	0.99
IGL01369:Ptch1	APN	13	63511681	missense	probably benign
IGL02260:Ptch1	APN	13	63565352	unclassified	probably benign
IGL02439:Ptch1	APN	13	63545096	missense	probably damaging	1.00
IGL02588:Ptch1	APN	13	63511918	missense	probably benign	0.13
IGL02797:Ptch1	APN	13	63533607	missense	probably benign
R0463:Ptch1	UTSW	13	63520307	missense	probably damaging	0.98
R0539:Ptch1	UTSW	13	63543480	splice site	probably benign
R0657:Ptch1	UTSW	13	63513751	missense	possibly damaging	0.90
R0971:Ptch1	UTSW	13	63539843	missense	probably benign	0.23
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1539:Ptch1	UTSW	13	63541287	missense	probably benign	0.00
R1616:Ptch1	UTSW	13	63539842	missense	possibly damaging	0.96
R1883:Ptch1	UTSW	13	63512027	nonsense	probably null
R1985:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R1986:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2024:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2025:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2026:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2027:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2096:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2097:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2100:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2105:Ptch1	UTSW	13	63545245	missense	probably benign
R2165:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2166:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2167:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2168:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2226:Ptch1	UTSW	13	63513671	missense	probably damaging	1.00
R2437:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2504:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2507:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2696:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63542224	missense	probably damaging	1.00
R2971:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3410:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3708:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3744:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3745:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3783:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3784:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3785:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3807:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3950:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4013:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4015:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4016:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4017:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4035:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4083:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4084:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4179:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4222:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4348:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4349:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4350:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4351:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4353:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4485:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4595:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R4625:Ptch1	UTSW	13	63523164	missense	probably benign	0.02
R4809:Ptch1	UTSW	13	63513708	missense	probably damaging	0.98
R4904:Ptch1	UTSW	13	63523004	missense	probably damaging	1.00
R4942:Ptch1	UTSW	13	63525070	missense	probably benign	0.02
R5386:Ptch1	UTSW	13	63545043	missense	probably damaging	0.98
R5447:Ptch1	UTSW	13	63527245	missense	probably benign
R5604:Ptch1	UTSW	13	63525122	missense	probably benign	0.01
R5846:Ptch1	UTSW	13	63565454	unclassified	probably benign
R5926:Ptch1	UTSW	13	63545055	missense	probably benign	0.01
R5945:Ptch1	UTSW	13	63573419	utr 5 prime	probably benign
R5957:Ptch1	UTSW	13	63525115	missense	probably damaging	1.00
R6326:Ptch1	UTSW	13	63543545	missense	probably damaging	1.00
R6358:Ptch1	UTSW	13	63513689	missense	probably damaging	0.96
R6376:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R6599:Ptch1	UTSW	13	63523104	missense	probably damaging	0.98
R6615:Ptch1	UTSW	13	63539830	missense	possibly damaging	0.46
R6965:Ptch1	UTSW	13	63525067	missense	possibly damaging	0.63
R7149:Ptch1	UTSW	13	63511736	missense	probably benign	0.23
R7168:Ptch1	UTSW	13	63512060	missense	probably benign
R7257:Ptch1	UTSW	13	63573294	missense	not run
R7258:Ptch1	UTSW	13	63573294	missense	not run
R7259:Ptch1	UTSW	13	63573294	missense	not run
R7368:Ptch1	UTSW	13	63511984	missense	probably benign	0.06
R7525:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7528:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7820:Ptch1	UTSW	13	63523061	missense	probably damaging	1.00
R8077:Ptch1	UTSW	13	63540812	missense	probably damaging	0.98
R8373:Ptch1	UTSW	13	63541168	missense	probably damaging	1.00
R8398:Ptch1	UTSW	13	63525125	missense	probably benign	0.06
R8407:Ptch1	UTSW	13	63514243	missense	probably null	1.00
R8839:Ptch1	UTSW	13	63541224	missense	probably damaging	1.00
R9075:Ptch1	UTSW	13	63533521	missense	possibly damaging	0.87
R9476:Ptch1	UTSW	13	63533634	missense	probably benign	0.05
R9514:Ptch1	UTSW	13	63527257	missense	probably benign
R9528:Ptch1	UTSW	13	63513801	missense	probably benign	0.00
R9568:Ptch1	UTSW	13	63542173	missense	probably damaging	0.99
Z1177:Ptch1	UTSW	13	63520279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GACTCTGGCGTTAGAAGGATCC -3'
(R):5'- ACCTCAGACTTTGTGGAAGC -3'

Sequencing Primer
(F):5'- TGGCGTTAGAAGGATCCCCATG -3'
(R):5'- CCTCAGACTTTGTGGAAGCCATAG -3'

Posted On

2016-04-15