Incidental Mutation 'R0244:Sorcs2'
ID37959
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Namesortilin-related VPS10 domain containing receptor 2
SynonymsVPS10 domain receptor protein
MMRRC Submission 038482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0244 (G1)
Quality Score218
Status Validated
Chromosome5
Chromosomal Location36017180-36398139 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 36397553 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000070720]
Predicted Effect probably benign
Transcript: ENSMUST00000037370
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070720
SMART Domains Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
Blast:VPS10 170 213 2e-22 BLAST
low complexity region 214 227 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137040
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,491 probably null Het
Adamdec1 A T 14: 68,568,723 C434* probably null Het
Adprhl1 A G 8: 13,242,391 probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Arel1 T C 12: 84,920,693 T786A probably damaging Het
Arhgap26 A G 18: 39,363,131 K117R probably benign Het
Atp6v0b C T 4: 117,884,622 G204D probably damaging Het
Bace2 T A 16: 97,436,773 probably null Het
Camk4 G A 18: 33,179,625 probably null Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cep152 T C 2: 125,564,214 E1466G probably benign Het
Ces3b T C 8: 105,092,635 F441S probably damaging Het
Cfap52 T C 11: 67,926,382 T562A possibly damaging Het
Clca3a2 C A 3: 144,813,898 M238I possibly damaging Het
Cntnap5c A T 17: 58,102,168 D467V probably damaging Het
Col7a1 T A 9: 108,972,184 probably null Het
Cstf1 A G 2: 172,377,710 N247S possibly damaging Het
Dffb G T 4: 153,974,615 N68K probably benign Het
Duox2 C T 2: 122,291,860 G595S probably benign Het
Eftud2 T A 11: 102,864,725 I228F probably damaging Het
Elmo3 T C 8: 105,309,171 V578A probably benign Het
Elp2 A G 18: 24,631,471 D625G possibly damaging Het
Ep300 C T 15: 81,640,128 P1386S unknown Het
Fam120b A G 17: 15,417,637 D610G probably damaging Het
Fastk A T 5: 24,442,178 probably benign Het
Fbxl6 A G 15: 76,537,191 S252P probably damaging Het
Fbxo43 T C 15: 36,161,793 K423E probably damaging Het
Filip1 T A 9: 79,819,462 E625V possibly damaging Het
Fkbp9 T A 6: 56,856,378 Y283* probably null Het
Gigyf2 T A 1: 87,379,015 D142E possibly damaging Het
Gm10142 T C 10: 77,716,014 probably null Het
Golga5 T C 12: 102,476,188 V262A probably benign Het
Hectd4 T C 5: 121,329,605 V2539A probably benign Het
Ica1 G T 6: 8,653,632 S335* probably null Het
Itga1 A T 13: 115,006,897 probably benign Het
Itgb1 T C 8: 128,717,685 probably benign Het
Itpr1 G A 6: 108,473,589 V1960I probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kprp C T 3: 92,825,411 V111I probably benign Het
Lamc3 T C 2: 31,940,721 I1490T probably damaging Het
Lcp1 A T 14: 75,227,001 D554V possibly damaging Het
Lgi3 A G 14: 70,534,698 T228A probably benign Het
Lipa A T 19: 34,501,541 F260I probably damaging Het
Lrriq1 C T 10: 103,215,773 E373K probably damaging Het
Map6 G A 7: 99,336,836 G649D probably benign Het
Mccc1 A G 3: 35,990,047 probably null Het
Mical3 A T 6: 120,957,722 S1799T probably benign Het
Mmp23 T A 4: 155,652,132 T151S probably damaging Het
Myo1d T A 11: 80,674,708 N401I probably damaging Het
Myo9b T A 8: 71,321,813 S323T probably damaging Het
Nbn G T 4: 15,979,353 W446L probably benign Het
Nedd1 A T 10: 92,716,265 probably benign Het
Ngef C A 1: 87,487,962 probably benign Het
Nup153 A T 13: 46,693,936 N672K probably benign Het
Olfr1308 T C 2: 111,961,016 N19S probably benign Het
Olfr149 T A 9: 39,702,173 I199F probably damaging Het
Olfr1509 T C 14: 52,450,512 V33A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Palm2 T G 4: 57,710,177 V374G possibly damaging Het
Pdlim3 C A 8: 45,908,460 probably benign Het
Pmfbp1 G A 8: 109,541,673 E951K probably damaging Het
Pop1 T A 15: 34,515,891 C548* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ptpdc1 A T 13: 48,585,980 N658K probably benign Het
Ptprk A C 10: 28,206,225 E63D possibly damaging Het
Rtf1 C T 2: 119,732,877 R712W probably damaging Het
Samd7 A C 3: 30,751,073 T2P probably benign Het
Sft2d1 A G 17: 8,319,422 T52A probably benign Het
Slc25a26 A G 6: 94,510,833 H91R probably damaging Het
Slc5a4a A G 10: 76,189,152 E621G possibly damaging Het
Slf1 A T 13: 77,126,632 L28* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tacc2 T C 7: 130,751,825 probably benign Het
Tas2r140 A G 6: 133,055,327 V156A possibly damaging Het
Terf2ip C A 8: 112,018,164 T371K possibly damaging Het
Tifa C T 3: 127,796,888 L103F probably damaging Het
Tmco3 A G 8: 13,292,037 N104D probably damaging Het
Tmem259 T A 10: 79,978,963 D240V probably damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Trps1 T C 15: 50,664,743 N725D probably damaging Het
Ttn C T 2: 76,814,806 V12902M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Unc79 A G 12: 103,112,891 K1772E probably damaging Het
Vwde C T 6: 13,193,126 V405I probably benign Het
Wdr18 T A 10: 79,966,408 D290E probably damaging Het
Wdr92 T C 11: 17,229,851 L284P probably damaging Het
Wwc2 G A 8: 47,900,721 A126V probably benign Het
Zfp882 A T 8: 71,913,523 I105F possibly damaging Het
Zfp942 A T 17: 21,928,572 C359S probably benign Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36037401 splice site probably null
IGL01064:Sorcs2 APN 5 36065352 missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36021252 missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36047809 missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36025942 missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36062552 missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36077957 missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36068148 missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36065331 unclassified probably benign
IGL03141:Sorcs2 APN 5 36065355 missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36031212 missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36046504 missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36153845 missense probably damaging 1.00
R0345:Sorcs2 UTSW 5 36027874 missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36031190 missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36065433 missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36024572 missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36027925 missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36026748 missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36229220 splice site probably benign
R1935:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36042086 splice site probably null
R3148:Sorcs2 UTSW 5 36035788 missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36397806 missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36397663 nonsense probably null
R4092:Sorcs2 UTSW 5 36025822 missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36037494 missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36043452 missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36039390 missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36031183 missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36046530 nonsense probably null
R5727:Sorcs2 UTSW 5 36031286 missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36229211 missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36229191 missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36029083 missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36019384 missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36027988 splice site probably null
R6290:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36077966 missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36397810 missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36021261 missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36068130 missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36025876 missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36027978 missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36043527 missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36229175 missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36024072 missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36024614 missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36062614 missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36062588 missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36038206 missense probably benign 0.00
RF063:Sorcs2 UTSW 5 36153811 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTTCTGAGCGAGACAGAATCTCAC -3'
(R):5'- TCCCGGTGTGCAGATCACTAGG -3'

Sequencing Primer
(F):5'- TTCGAGGACCCTTCCAAAAG -3'
(R):5'- TGCAGATCACTAGGCTGCTG -3'
Posted On2013-05-23