Incidental Mutation 'R4912:Ercc5'
ID 379595
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms Xpg
MMRRC Submission 042514-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4912 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 44147744-44181260 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44157057 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 70 (I70T)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027214
AA Change: I70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: I70T

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155862
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,419,856 D52G possibly damaging Het
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
Acaa1a C A 9: 119,342,761 R102S probably damaging Het
Arhgef12 G A 9: 42,993,065 R706* probably null Het
Best3 A G 10: 117,008,981 Y347C probably damaging Het
Birc6 T A 17: 74,565,905 D386E probably damaging Het
C130050O18Rik A T 5: 139,414,389 T66S probably benign Het
Chd9 A T 8: 91,034,230 D2201V possibly damaging Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Dffb T A 4: 153,965,407 probably benign Het
Diaph3 A C 14: 87,007,199 C217W probably damaging Het
Eml2 T A 7: 19,193,999 probably null Het
Fryl AGTGTGT AGTGT 5: 73,068,782 probably null Het
Fsd1 C T 17: 55,991,241 P189S possibly damaging Het
Gm42669 A G 5: 107,508,817 K982R probably damaging Het
Gm5414 A G 15: 101,625,010 I373T possibly damaging Het
Gm7356 A G 17: 14,001,236 L177P possibly damaging Het
Grip1 G A 10: 119,931,248 D93N probably damaging Het
Hbq1b T A 11: 32,287,014 M1K probably null Het
Hps3 C A 3: 20,014,173 L572F probably damaging Het
Ighj2 T A 12: 113,429,480 probably benign Het
Kcna3 T C 3: 107,037,891 M490T probably benign Het
Krt76 T A 15: 101,888,162 K404* probably null Het
Lgr4 A T 2: 110,006,502 probably null Het
Ltbp4 G T 7: 27,306,116 C1533* probably null Het
Mapre2 A G 18: 23,832,933 N25S probably damaging Het
Mark3 T A 12: 111,592,653 I43K probably benign Het
Mon1b T A 8: 113,641,953 Y495* probably null Het
Mrfap1 A G 5: 36,796,745 probably benign Het
Mxra8 A G 4: 155,840,904 probably null Het
Myoz1 A T 14: 20,649,538 L244Q probably damaging Het
Ndfip2 C T 14: 105,258,685 R5W probably benign Het
Nek11 T C 9: 105,287,658 D423G probably benign Het
Nin A T 12: 70,044,063 D859E probably damaging Het
Nup210 G A 6: 91,017,529 A1729V probably benign Het
Olfm3 A G 3: 115,101,940 E157G probably damaging Het
Olfr397 A T 11: 73,965,340 H244L probably damaging Het
Prickle1 A G 15: 93,500,548 S800P probably benign Het
Reln A G 5: 21,925,193 S2707P probably benign Het
Rexo4 G A 2: 26,962,392 T200M possibly damaging Het
Saxo2 T A 7: 82,634,535 I372L probably benign Het
Scgb2b2 T A 7: 31,303,631 D50E probably benign Het
Sipa1l1 T C 12: 82,396,678 L914P possibly damaging Het
Slf1 T A 13: 77,051,294 D656V probably damaging Het
Sorbs1 T C 19: 40,311,727 D1192G probably damaging Het
Tdrd6 A C 17: 43,624,327 D1943E probably benign Het
Tmem163 G A 1: 127,491,625 T281M probably damaging Het
Tmod3 A G 9: 75,532,448 V35A probably damaging Het
Ttc39c A T 18: 12,734,894 Q448L probably benign Het
Ulk1 A T 5: 110,787,589 S937T probably damaging Het
Unc13c T A 9: 73,574,022 D1711V probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Utp20 G T 10: 88,771,960 Q1596K probably benign Het
Vmn1r28 A T 6: 58,265,540 I123F possibly damaging Het
Vmn1r73 T A 7: 11,756,669 V138E probably damaging Het
Vmn2r112 A G 17: 22,603,382 D347G probably damaging Het
Vmn2r3 T G 3: 64,259,197 T838P probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wdr17 T C 8: 54,629,861 D1268G probably damaging Het
Zfp108 T A 7: 24,261,314 H443Q probably damaging Het
Zfp608 A G 18: 54,946,591 V374A probably damaging Het
Zfp831 G T 2: 174,644,624 G364V probably damaging Het
Zfp94 A G 7: 24,303,741 V86A probably benign Het
Zkscan16 A C 4: 58,946,506 N127T possibly damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44178334 missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44167681 nonsense probably null
R8795:Ercc5 UTSW 1 44163929 missense possibly damaging 0.92
R9144:Ercc5 UTSW 1 44174351 missense probably damaging 1.00
R9208:Ercc5 UTSW 1 44178343 missense possibly damaging 0.51
R9295:Ercc5 UTSW 1 44158857 missense probably damaging 1.00
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTGAGGATGAAGCTGAAAATTGC -3'
(R):5'- GCAGACGTACACAAATGGTTAAC -3'

Sequencing Primer
(F):5'- GCTGAAAATTGCCAACTGTTTTCC -3'
(R):5'- TGGCAGGATTTTGAAGGAGACTG -3'
Posted On 2016-04-15