Incidental Mutation 'R4912:Vmn1r73'
ID379626
Institutional Source Beutler Lab
Gene Symbol Vmn1r73
Ensembl Gene ENSMUSG00000051687
Gene Namevomeronasal 1 receptor 73
SynonymsV1rg2
MMRRC Submission 042514-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4912 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location11730266-11762081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11756669 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 138 (V138E)
Ref Sequence ENSEMBL: ENSMUSP00000153827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055070] [ENSMUST00000226516]
Predicted Effect probably damaging
Transcript: ENSMUST00000055070
AA Change: V138E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055353
Gene: ENSMUSG00000051687
AA Change: V138E

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 7.5e-7 PFAM
Pfam:V1R 32 297 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226516
AA Change: V138E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,419,856 D52G possibly damaging Het
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
Acaa1a C A 9: 119,342,761 R102S probably damaging Het
Arhgef12 G A 9: 42,993,065 R706* probably null Het
Best3 A G 10: 117,008,981 Y347C probably damaging Het
Birc6 T A 17: 74,565,905 D386E probably damaging Het
C130050O18Rik A T 5: 139,414,389 T66S probably benign Het
Chd9 A T 8: 91,034,230 D2201V possibly damaging Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Dffb T A 4: 153,965,407 probably benign Het
Diaph3 A C 14: 87,007,199 C217W probably damaging Het
Eml2 T A 7: 19,193,999 probably null Het
Ercc5 T C 1: 44,157,057 I70T probably damaging Het
Fryl AGTGTGT AGTGT 5: 73,068,782 probably null Het
Fsd1 C T 17: 55,991,241 P189S possibly damaging Het
Gm42669 A G 5: 107,508,817 K982R probably damaging Het
Gm5414 A G 15: 101,625,010 I373T possibly damaging Het
Gm7356 A G 17: 14,001,236 L177P possibly damaging Het
Grip1 G A 10: 119,931,248 D93N probably damaging Het
Hbq1b T A 11: 32,287,014 M1K probably null Het
Hps3 C A 3: 20,014,173 L572F probably damaging Het
Ighj2 T A 12: 113,429,480 probably benign Het
Kcna3 T C 3: 107,037,891 M490T probably benign Het
Krt76 T A 15: 101,888,162 K404* probably null Het
Lgr4 A T 2: 110,006,502 probably null Het
Ltbp4 G T 7: 27,306,116 C1533* probably null Het
Mapre2 A G 18: 23,832,933 N25S probably damaging Het
Mark3 T A 12: 111,592,653 I43K probably benign Het
Mon1b T A 8: 113,641,953 Y495* probably null Het
Mrfap1 A G 5: 36,796,745 probably benign Het
Mxra8 A G 4: 155,840,904 probably null Het
Myoz1 A T 14: 20,649,538 L244Q probably damaging Het
Ndfip2 C T 14: 105,258,685 R5W probably benign Het
Nek11 T C 9: 105,287,658 D423G probably benign Het
Nin A T 12: 70,044,063 D859E probably damaging Het
Nup210 G A 6: 91,017,529 A1729V probably benign Het
Olfm3 A G 3: 115,101,940 E157G probably damaging Het
Olfr397 A T 11: 73,965,340 H244L probably damaging Het
Prickle1 A G 15: 93,500,548 S800P probably benign Het
Reln A G 5: 21,925,193 S2707P probably benign Het
Rexo4 G A 2: 26,962,392 T200M possibly damaging Het
Saxo2 T A 7: 82,634,535 I372L probably benign Het
Scgb2b2 T A 7: 31,303,631 D50E probably benign Het
Sipa1l1 T C 12: 82,396,678 L914P possibly damaging Het
Slf1 T A 13: 77,051,294 D656V probably damaging Het
Sorbs1 T C 19: 40,311,727 D1192G probably damaging Het
Tdrd6 A C 17: 43,624,327 D1943E probably benign Het
Tmem163 G A 1: 127,491,625 T281M probably damaging Het
Tmod3 A G 9: 75,532,448 V35A probably damaging Het
Ttc39c A T 18: 12,734,894 Q448L probably benign Het
Ulk1 A T 5: 110,787,589 S937T probably damaging Het
Unc13c T A 9: 73,574,022 D1711V probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Utp20 G T 10: 88,771,960 Q1596K probably benign Het
Vmn1r28 A T 6: 58,265,540 I123F possibly damaging Het
Vmn2r112 A G 17: 22,603,382 D347G probably damaging Het
Vmn2r3 T G 3: 64,259,197 T838P probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wdr17 T C 8: 54,629,861 D1268G probably damaging Het
Zfp108 T A 7: 24,261,314 H443Q probably damaging Het
Zfp608 A G 18: 54,946,591 V374A probably damaging Het
Zfp831 G T 2: 174,644,624 G364V probably damaging Het
Zfp94 A G 7: 24,303,741 V86A probably benign Het
Zkscan16 A C 4: 58,946,506 N127T possibly damaging Het
Other mutations in Vmn1r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Vmn1r73 APN 7 11756738 missense probably benign 0.02
IGL02337:Vmn1r73 APN 7 11756713 missense possibly damaging 0.69
IGL02666:Vmn1r73 APN 7 11756938 missense probably damaging 1.00
IGL02741:Vmn1r73 APN 7 11756783 missense probably benign 0.05
IGL02756:Vmn1r73 APN 7 11756647 missense possibly damaging 0.95
IGL03113:Vmn1r73 APN 7 11756600 missense probably benign
IGL03195:Vmn1r73 APN 7 11757080 missense probably damaging 1.00
R0023:Vmn1r73 UTSW 7 11757070 missense probably benign 0.43
R0379:Vmn1r73 UTSW 7 11756846 missense probably benign 0.16
R3941:Vmn1r73 UTSW 7 11756755 missense probably damaging 1.00
R4224:Vmn1r73 UTSW 7 11756579 missense probably damaging 0.99
R4631:Vmn1r73 UTSW 7 11756831 missense probably benign 0.22
R5060:Vmn1r73 UTSW 7 11756756 missense probably damaging 1.00
R5450:Vmn1r73 UTSW 7 11756449 missense possibly damaging 0.63
R5609:Vmn1r73 UTSW 7 11756664 nonsense probably null
R6059:Vmn1r73 UTSW 7 11756611 missense probably benign 0.40
R6508:Vmn1r73 UTSW 7 11756704 missense possibly damaging 0.73
R6967:Vmn1r73 UTSW 7 11756617 nonsense probably null
R7099:Vmn1r73 UTSW 7 11756393 missense probably damaging 1.00
R7304:Vmn1r73 UTSW 7 11756897 missense probably damaging 1.00
R7579:Vmn1r73 UTSW 7 11757155 missense probably benign 0.08
R7891:Vmn1r73 UTSW 7 11757109 missense possibly damaging 0.87
Z1176:Vmn1r73 UTSW 7 11756956 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGGCATTCCACAGACACTG -3'
(R):5'- TGAGACCCAGACATAGTCCATC -3'

Sequencing Primer
(F):5'- CCACAGACACTGTTGAATTATGG -3'
(R):5'- TAGTCCATCAGAGAAACACAGTAAG -3'
Posted On2016-04-15