Incidental Mutation 'R4912:Arhgef12'
ID379637
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission 042514-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R4912 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 42993065 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 706 (R706*)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect probably null
Transcript: ENSMUST00000072767
AA Change: R705*
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: R705*

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165665
AA Change: R706*
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: R706*

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,419,856 D52G possibly damaging Het
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
Acaa1a C A 9: 119,342,761 R102S probably damaging Het
Best3 A G 10: 117,008,981 Y347C probably damaging Het
Birc6 T A 17: 74,565,905 D386E probably damaging Het
C130050O18Rik A T 5: 139,414,389 T66S probably benign Het
Chd9 A T 8: 91,034,230 D2201V possibly damaging Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Dffb T A 4: 153,965,407 probably benign Het
Diaph3 A C 14: 87,007,199 C217W probably damaging Het
Eml2 T A 7: 19,193,999 probably null Het
Ercc5 T C 1: 44,157,057 I70T probably damaging Het
Fryl AGTGTGT AGTGT 5: 73,068,782 probably null Het
Fsd1 C T 17: 55,991,241 P189S possibly damaging Het
Gm42669 A G 5: 107,508,817 K982R probably damaging Het
Gm5414 A G 15: 101,625,010 I373T possibly damaging Het
Gm7356 A G 17: 14,001,236 L177P possibly damaging Het
Grip1 G A 10: 119,931,248 D93N probably damaging Het
Hbq1b T A 11: 32,287,014 M1K probably null Het
Hps3 C A 3: 20,014,173 L572F probably damaging Het
Ighj2 T A 12: 113,429,480 probably benign Het
Kcna3 T C 3: 107,037,891 M490T probably benign Het
Krt76 T A 15: 101,888,162 K404* probably null Het
Lgr4 A T 2: 110,006,502 probably null Het
Ltbp4 G T 7: 27,306,116 C1533* probably null Het
Mapre2 A G 18: 23,832,933 N25S probably damaging Het
Mark3 T A 12: 111,592,653 I43K probably benign Het
Mon1b T A 8: 113,641,953 Y495* probably null Het
Mrfap1 A G 5: 36,796,745 probably benign Het
Mxra8 A G 4: 155,840,904 probably null Het
Myoz1 A T 14: 20,649,538 L244Q probably damaging Het
Ndfip2 C T 14: 105,258,685 R5W probably benign Het
Nek11 T C 9: 105,287,658 D423G probably benign Het
Nin A T 12: 70,044,063 D859E probably damaging Het
Nup210 G A 6: 91,017,529 A1729V probably benign Het
Olfm3 A G 3: 115,101,940 E157G probably damaging Het
Olfr397 A T 11: 73,965,340 H244L probably damaging Het
Prickle1 A G 15: 93,500,548 S800P probably benign Het
Reln A G 5: 21,925,193 S2707P probably benign Het
Rexo4 G A 2: 26,962,392 T200M possibly damaging Het
Saxo2 T A 7: 82,634,535 I372L probably benign Het
Scgb2b2 T A 7: 31,303,631 D50E probably benign Het
Sipa1l1 T C 12: 82,396,678 L914P possibly damaging Het
Slf1 T A 13: 77,051,294 D656V probably damaging Het
Sorbs1 T C 19: 40,311,727 D1192G probably damaging Het
Tdrd6 A C 17: 43,624,327 D1943E probably benign Het
Tmem163 G A 1: 127,491,625 T281M probably damaging Het
Tmod3 A G 9: 75,532,448 V35A probably damaging Het
Ttc39c A T 18: 12,734,894 Q448L probably benign Het
Ulk1 A T 5: 110,787,589 S937T probably damaging Het
Unc13c T A 9: 73,574,022 D1711V probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Utp20 G T 10: 88,771,960 Q1596K probably benign Het
Vmn1r28 A T 6: 58,265,540 I123F possibly damaging Het
Vmn1r73 T A 7: 11,756,669 V138E probably damaging Het
Vmn2r112 A G 17: 22,603,382 D347G probably damaging Het
Vmn2r3 T G 3: 64,259,197 T838P probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wdr17 T C 8: 54,629,861 D1268G probably damaging Het
Zfp108 T A 7: 24,261,314 H443Q probably damaging Het
Zfp608 A G 18: 54,946,591 V374A probably damaging Het
Zfp831 G T 2: 174,644,624 G364V probably damaging Het
Zfp94 A G 7: 24,303,741 V86A probably benign Het
Zkscan16 A C 4: 58,946,506 N127T possibly damaging Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42992536 missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 43027271 missense probably damaging 1.00
R8074:Arhgef12 UTSW 9 42971103 nonsense probably null
RF020:Arhgef12 UTSW 9 42989989 missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42971072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGCCACCCTAAAACAGTAGAG -3'
(R):5'- CTAGCCTATTGAAATAGAATGTGGC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCAGGAGG -3'
(R):5'- GGCTATGATTTAGGAAAAAGTTTTGG -3'
Posted On2016-04-15