Mutagenetix > Incidental Mutation

Incidental Mutation 'R4912:Best3'

379644

Institutional Source

Beutler Lab

Gene Symbol

Best3

Ensembl Gene

ENSMUSG00000020169

Gene Name

bestrophin 3

Synonyms

mBest4, Vmd2l3

MMRRC Submission

042514-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R4912 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116986314-117025040 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 117008981 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 347 (Y347C)

Ref Sequence

ENSEMBL: ENSMUSP00000020378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020378]

AlphaFold

Q6H1V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000020378
AA Change: Y347C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020378
Gene: ENSMUSG00000020169
AA Change: Y347C

Domain	Start	End	E-Value	Type
Pfam:Bestrophin	8	316	7.3e-115	PFAM
low complexity region	405	416	N/A	INTRINSIC
low complexity region	473	492	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]; Tsunenari et al., 2003 [PubMed 12907679]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,419,856	D52G	possibly damaging	Het
2810474O19Rik	C	G	6: 149,329,389	S1311C	probably damaging	Het
Acaa1a	C	A	9: 119,342,761	R102S	probably damaging	Het
Arhgef12	G	A	9: 42,993,065	R706*	probably null	Het
Birc6	T	A	17: 74,565,905	D386E	probably damaging	Het
C130050O18Rik	A	T	5: 139,414,389	T66S	probably benign	Het
Chd9	A	T	8: 91,034,230	D2201V	possibly damaging	Het
Csk	A	G	9: 57,630,780	Y48H	probably damaging	Het
Dffb	T	A	4: 153,965,407		probably benign	Het
Diaph3	A	C	14: 87,007,199	C217W	probably damaging	Het
Eml2	T	A	7: 19,193,999		probably null	Het
Ercc5	T	C	1: 44,157,057	I70T	probably damaging	Het
Fryl	AGTGTGT	AGTGT	5: 73,068,782		probably null	Het
Fsd1	C	T	17: 55,991,241	P189S	possibly damaging	Het
Gm42669	A	G	5: 107,508,817	K982R	probably damaging	Het
Gm5414	A	G	15: 101,625,010	I373T	possibly damaging	Het
Gm7356	A	G	17: 14,001,236	L177P	possibly damaging	Het
Grip1	G	A	10: 119,931,248	D93N	probably damaging	Het
Hbq1b	T	A	11: 32,287,014	M1K	probably null	Het
Hps3	C	A	3: 20,014,173	L572F	probably damaging	Het
Ighj2	T	A	12: 113,429,480		probably benign	Het
Kcna3	T	C	3: 107,037,891	M490T	probably benign	Het
Krt76	T	A	15: 101,888,162	K404*	probably null	Het
Lgr4	A	T	2: 110,006,502		probably null	Het
Ltbp4	G	T	7: 27,306,116	C1533*	probably null	Het
Mapre2	A	G	18: 23,832,933	N25S	probably damaging	Het
Mark3	T	A	12: 111,592,653	I43K	probably benign	Het
Mon1b	T	A	8: 113,641,953	Y495*	probably null	Het
Mrfap1	A	G	5: 36,796,745		probably benign	Het
Mxra8	A	G	4: 155,840,904		probably null	Het
Myoz1	A	T	14: 20,649,538	L244Q	probably damaging	Het
Ndfip2	C	T	14: 105,258,685	R5W	probably benign	Het
Nek11	T	C	9: 105,287,658	D423G	probably benign	Het
Nin	A	T	12: 70,044,063	D859E	probably damaging	Het
Nup210	G	A	6: 91,017,529	A1729V	probably benign	Het
Olfm3	A	G	3: 115,101,940	E157G	probably damaging	Het
Olfr397	A	T	11: 73,965,340	H244L	probably damaging	Het
Prickle1	A	G	15: 93,500,548	S800P	probably benign	Het
Reln	A	G	5: 21,925,193	S2707P	probably benign	Het
Rexo4	G	A	2: 26,962,392	T200M	possibly damaging	Het
Saxo2	T	A	7: 82,634,535	I372L	probably benign	Het
Scgb2b2	T	A	7: 31,303,631	D50E	probably benign	Het
Sipa1l1	T	C	12: 82,396,678	L914P	possibly damaging	Het
Slf1	T	A	13: 77,051,294	D656V	probably damaging	Het
Sorbs1	T	C	19: 40,311,727	D1192G	probably damaging	Het
Tdrd6	A	C	17: 43,624,327	D1943E	probably benign	Het
Tmem163	G	A	1: 127,491,625	T281M	probably damaging	Het
Tmod3	A	G	9: 75,532,448	V35A	probably damaging	Het
Ttc39c	A	T	18: 12,734,894	Q448L	probably benign	Het
Ulk1	A	T	5: 110,787,589	S937T	probably damaging	Het
Unc13c	T	A	9: 73,574,022	D1711V	probably damaging	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Utp20	G	T	10: 88,771,960	Q1596K	probably benign	Het
Vmn1r28	A	T	6: 58,265,540	I123F	possibly damaging	Het
Vmn1r73	T	A	7: 11,756,669	V138E	probably damaging	Het
Vmn2r112	A	G	17: 22,603,382	D347G	probably damaging	Het
Vmn2r3	T	G	3: 64,259,197	T838P	probably damaging	Het
Vps13d	A	T	4: 145,155,857	D1055E	probably benign	Het
Wdr17	T	C	8: 54,629,861	D1268G	probably damaging	Het
Zfp108	T	A	7: 24,261,314	H443Q	probably damaging	Het
Zfp608	A	G	18: 54,946,591	V374A	probably damaging	Het
Zfp831	G	T	2: 174,644,624	G364V	probably damaging	Het
Zfp94	A	G	7: 24,303,741	V86A	probably benign	Het
Zkscan16	A	C	4: 58,946,506	N127T	possibly damaging	Het

Other mutations in Best3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Best3	APN	10	116988727	missense	probably damaging	1.00
IGL00158:Best3	APN	10	117004541	splice site	probably benign
IGL02493:Best3	APN	10	117024601	missense	possibly damaging	0.95
IGL02713:Best3	APN	10	117024529	missense	probably benign	0.00
IGL03178:Best3	APN	10	116988779	missense	probably damaging	1.00
IGL03355:Best3	APN	10	116993105	missense	possibly damaging	0.82
R0531:Best3	UTSW	10	117004375	splice site	probably benign
R0578:Best3	UTSW	10	117008999	missense	probably benign	0.06
R1671:Best3	UTSW	10	117024668	missense	possibly damaging	0.58
R1769:Best3	UTSW	10	117023978	missense	probably benign	0.00
R1860:Best3	UTSW	10	116993273	missense	probably damaging	1.00
R1935:Best3	UTSW	10	117024386	missense	probably benign
R2103:Best3	UTSW	10	117002594	missense	probably benign	0.01
R3942:Best3	UTSW	10	116988674	missense	possibly damaging	0.49
R4260:Best3	UTSW	10	117024226	missense	probably benign
R4332:Best3	UTSW	10	117002524	missense	probably benign	0.37
R4741:Best3	UTSW	10	117023996	missense	probably benign	0.06
R4760:Best3	UTSW	10	117024794	missense	probably benign	0.00
R4896:Best3	UTSW	10	117024555	missense	probably benign	0.00
R5023:Best3	UTSW	10	116988742	missense	probably benign	0.06
R5087:Best3	UTSW	10	117009002	missense	probably benign	0.01
R5213:Best3	UTSW	10	117024472	missense	probably benign	0.01
R5457:Best3	UTSW	10	117004511	missense	probably damaging	1.00
R5928:Best3	UTSW	10	117007627	missense	probably damaging	1.00
R5982:Best3	UTSW	10	117004417	missense	probably damaging	0.98
R6335:Best3	UTSW	10	117002651	missense	probably benign	0.32
R7068:Best3	UTSW	10	116988638	missense	probably damaging	1.00
R7469:Best3	UTSW	10	117004385	missense	probably damaging	1.00
R8139:Best3	UTSW	10	117004426	missense	probably damaging	1.00
R8306:Best3	UTSW	10	117002610	missense	probably damaging	1.00
R8715:Best3	UTSW	10	116993066	missense	probably damaging	1.00
R8847:Best3	UTSW	10	116988667	missense	possibly damaging	0.83
R9104:Best3	UTSW	10	117024775	missense	probably benign
R9506:Best3	UTSW	10	117003921	missense	probably damaging	0.99
R9579:Best3	UTSW	10	116993195	missense	probably damaging	0.96
R9635:Best3	UTSW	10	117002545	missense	probably damaging	0.99
RF014:Best3	UTSW	10	117004505	missense	probably damaging	1.00
Z1088:Best3	UTSW	10	117024170	missense	probably benign	0.00
Z1176:Best3	UTSW	10	117024622	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- GCAGCTAGTCTGTCTGTCTG -3'
(R):5'- CATGTCTGTATCATGTGGCTACG -3'

Sequencing Primer
(F):5'- AGTCTGTCTGTCTGGGCTTTCC -3'
(R):5'- CTGAGAATCCGAGTGATCCCAG -3'

Posted On

2016-04-15