Mutagenetix > Incidental Mutations

Incidental Mutation 'R4912:Krt76'

379657

Institutional Source

Beutler Lab

Gene Symbol

Krt76

Ensembl Gene

ENSMUSG00000075402

Gene Name

keratin 76

Synonyms

2310001L23Rik

MMRRC Submission

042514-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4912 (G1)

Quality Score

213

Status

Not validated

Chromosome

Chromosomal Location

101884351-101892920 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 101888162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 404 (K404*)

Ref Sequence

ENSEMBL: ENSMUSP00000097754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100179]

AlphaFold

Q3UV17

Predicted Effect

probably null
Transcript: ENSMUST00000100179
AA Change: K404*

SMART Domains

Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: K404*

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	161	5.7e-39	PFAM
Filament	164	479	2.12e-166	SMART
low complexity region	488	551	N/A	INTRINSIC
low complexity region	565	593	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196731

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,419,856	D52G	possibly damaging	Het
2810474O19Rik	C	G	6: 149,329,389	S1311C	probably damaging	Het
Acaa1a	C	A	9: 119,342,761	R102S	probably damaging	Het
Arhgef12	G	A	9: 42,993,065	R706*	probably null	Het
Best3	A	G	10: 117,008,981	Y347C	probably damaging	Het
Birc6	T	A	17: 74,565,905	D386E	probably damaging	Het
C130050O18Rik	A	T	5: 139,414,389	T66S	probably benign	Het
Chd9	A	T	8: 91,034,230	D2201V	possibly damaging	Het
Csk	A	G	9: 57,630,780	Y48H	probably damaging	Het
Dffb	T	A	4: 153,965,407		probably benign	Het
Diaph3	A	C	14: 87,007,199	C217W	probably damaging	Het
Eml2	T	A	7: 19,193,999		probably null	Het
Ercc5	T	C	1: 44,157,057	I70T	probably damaging	Het
Fryl	AGTGTGT	AGTGT	5: 73,068,782		probably null	Het
Fsd1	C	T	17: 55,991,241	P189S	possibly damaging	Het
Gm42669	A	G	5: 107,508,817	K982R	probably damaging	Het
Gm5414	A	G	15: 101,625,010	I373T	possibly damaging	Het
Gm7356	A	G	17: 14,001,236	L177P	possibly damaging	Het
Grip1	G	A	10: 119,931,248	D93N	probably damaging	Het
Hbq1b	T	A	11: 32,287,014	M1K	probably null	Het
Hps3	C	A	3: 20,014,173	L572F	probably damaging	Het
Ighj2	T	A	12: 113,429,480		probably benign	Het
Kcna3	T	C	3: 107,037,891	M490T	probably benign	Het
Lgr4	A	T	2: 110,006,502		probably null	Het
Ltbp4	G	T	7: 27,306,116	C1533*	probably null	Het
Mapre2	A	G	18: 23,832,933	N25S	probably damaging	Het
Mark3	T	A	12: 111,592,653	I43K	probably benign	Het
Mon1b	T	A	8: 113,641,953	Y495*	probably null	Het
Mrfap1	A	G	5: 36,796,745		probably benign	Het
Mxra8	A	G	4: 155,840,904		probably null	Het
Myoz1	A	T	14: 20,649,538	L244Q	probably damaging	Het
Ndfip2	C	T	14: 105,258,685	R5W	probably benign	Het
Nek11	T	C	9: 105,287,658	D423G	probably benign	Het
Nin	A	T	12: 70,044,063	D859E	probably damaging	Het
Nup210	G	A	6: 91,017,529	A1729V	probably benign	Het
Olfm3	A	G	3: 115,101,940	E157G	probably damaging	Het
Olfr397	A	T	11: 73,965,340	H244L	probably damaging	Het
Prickle1	A	G	15: 93,500,548	S800P	probably benign	Het
Reln	A	G	5: 21,925,193	S2707P	probably benign	Het
Rexo4	G	A	2: 26,962,392	T200M	possibly damaging	Het
Saxo2	T	A	7: 82,634,535	I372L	probably benign	Het
Scgb2b2	T	A	7: 31,303,631	D50E	probably benign	Het
Sipa1l1	T	C	12: 82,396,678	L914P	possibly damaging	Het
Slf1	T	A	13: 77,051,294	D656V	probably damaging	Het
Sorbs1	T	C	19: 40,311,727	D1192G	probably damaging	Het
Tdrd6	A	C	17: 43,624,327	D1943E	probably benign	Het
Tmem163	G	A	1: 127,491,625	T281M	probably damaging	Het
Tmod3	A	G	9: 75,532,448	V35A	probably damaging	Het
Ttc39c	A	T	18: 12,734,894	Q448L	probably benign	Het
Ulk1	A	T	5: 110,787,589	S937T	probably damaging	Het
Unc13c	T	A	9: 73,574,022	D1711V	probably damaging	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Utp20	G	T	10: 88,771,960	Q1596K	probably benign	Het
Vmn1r28	A	T	6: 58,265,540	I123F	possibly damaging	Het
Vmn1r73	T	A	7: 11,756,669	V138E	probably damaging	Het
Vmn2r112	A	G	17: 22,603,382	D347G	probably damaging	Het
Vmn2r3	T	G	3: 64,259,197	T838P	probably damaging	Het
Vps13d	A	T	4: 145,155,857	D1055E	probably benign	Het
Wdr17	T	C	8: 54,629,861	D1268G	probably damaging	Het
Zfp108	T	A	7: 24,261,314	H443Q	probably damaging	Het
Zfp608	A	G	18: 54,946,591	V374A	probably damaging	Het
Zfp831	G	T	2: 174,644,624	G364V	probably damaging	Het
Zfp94	A	G	7: 24,303,741	V86A	probably benign	Het
Zkscan16	A	C	4: 58,946,506	N127T	possibly damaging	Het

Other mutations in Krt76

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Krt76	APN	15	101884888	missense	unknown
IGL01475:Krt76	APN	15	101888513	missense	probably benign	0.11
IGL01504:Krt76	APN	15	101888173	missense	probably damaging	1.00
IGL01506:Krt76	APN	15	101892400	missense	probably damaging	0.97
IGL01943:Krt76	APN	15	101889045	missense	probably null	0.98
IGL03164:Krt76	APN	15	101887451	missense	possibly damaging	0.50
PIT4378001:Krt76	UTSW	15	101892407	missense	probably damaging	0.99
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0448:Krt76	UTSW	15	101890647	missense	probably damaging	1.00
R0730:Krt76	UTSW	15	101887349	missense	probably damaging	1.00
R0920:Krt76	UTSW	15	101892439	missense	possibly damaging	0.80
R1568:Krt76	UTSW	15	101885008	missense	unknown
R1779:Krt76	UTSW	15	101892687	missense	unknown
R1869:Krt76	UTSW	15	101889487	critical splice donor site	probably null
R1911:Krt76	UTSW	15	101888165	nonsense	probably null
R2160:Krt76	UTSW	15	101888385	missense	probably damaging	1.00
R2504:Krt76	UTSW	15	101884858	missense	unknown
R4487:Krt76	UTSW	15	101890482	missense	possibly damaging	0.71
R4729:Krt76	UTSW	15	101889081	missense	probably damaging	1.00
R4747:Krt76	UTSW	15	101885745	missense	probably damaging	1.00
R5357:Krt76	UTSW	15	101887385	missense	probably benign	0.04
R6738:Krt76	UTSW	15	101887478	missense	probably benign	0.40
R7786:Krt76	UTSW	15	101890530	missense	probably damaging	0.98
R7808:Krt76	UTSW	15	101890494	missense	probably damaging	1.00
R7825:Krt76	UTSW	15	101887503	missense	possibly damaging	0.46
R8079:Krt76	UTSW	15	101888390	missense	possibly damaging	0.61
R8846:Krt76	UTSW	15	101887337	missense	probably damaging	1.00
R8980:Krt76	UTSW	15	101892555	missense	unknown
Z1088:Krt76	UTSW	15	101890551	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGCTTAAGGTCAACCCTG -3'
(R):5'- CCCACACTTTACAAGGCTGTG -3'

Sequencing Primer
(F):5'- TAAGGTCAACCCTGCAGTTG -3'
(R):5'- TACAAGGCTGTGCTGATCC -3'

Posted On

2016-04-15