Mutagenetix > Incidental Mutation

Incidental Mutation 'R0244:Mical3'

37966

Institutional Source

Beutler Lab

Gene Symbol

Mical3

Ensembl Gene

ENSMUSG00000051586

Gene Name

microtubule associated monooxygenase, calponin and LIM domain containing 3

Synonyms

MICAL-3, C130040D16Rik

MMRRC Submission

038482-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R0244 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

120931707-121130999 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 120957722 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1799 (S1799T)

Ref Sequence

ENSEMBL: ENSMUSP00000146544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000207889]

AlphaFold

Q8CJ19

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000098457

SMART Domains

Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
low complexity region	57	80	N/A	INTRINSIC
coiled coil region	114	148	N/A	INTRINSIC
low complexity region	191	225	N/A	INTRINSIC
coiled coil region	238	265	N/A	INTRINSIC
low complexity region	317	330	N/A	INTRINSIC
low complexity region	374	383	N/A	INTRINSIC
low complexity region	548	562	N/A	INTRINSIC
low complexity region	582	592	N/A	INTRINSIC
low complexity region	625	637	N/A	INTRINSIC
low complexity region	794	824	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
low complexity region	911	929	N/A	INTRINSIC
low complexity region	950	962	N/A	INTRINSIC
DUF3585	968	1110	1.39e-65	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124669

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150503

SMART Domains

Protein: ENSMUSP00000115131
Gene: ENSMUSG00000051586

Domain	Start	End	E-Value	Type
SCOP:d1bjt__	41	141	8e-3	SMART
coiled coil region	192	219	N/A	INTRINSIC
low complexity region	271	284	N/A	INTRINSIC
low complexity region	328	337	N/A	INTRINSIC
low complexity region	502	516	N/A	INTRINSIC
low complexity region	536	546	N/A	INTRINSIC
low complexity region	579	591	N/A	INTRINSIC
low complexity region	748	778	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151602

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203013

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205062

Predicted Effect

probably benign
Transcript: ENSMUST00000207889
AA Change: S1799T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

unknown
Transcript: ENSMUST00000212333
AA Change: S927T

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

99% (88/89)

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,286,491		probably null	Het
Adamdec1	A	T	14: 68,568,723	C434*	probably null	Het
Adprhl1	A	G	8: 13,242,391		probably benign	Het
Ago1	T	A	4: 126,463,706	I59F	possibly damaging	Het
Arel1	T	C	12: 84,920,693	T786A	probably damaging	Het
Arhgap26	A	G	18: 39,363,131	K117R	probably benign	Het
Atp6v0b	C	T	4: 117,884,622	G204D	probably damaging	Het
Bace2	T	A	16: 97,436,773		probably null	Het
Camk4	G	A	18: 33,179,625		probably null	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cep152	T	C	2: 125,564,214	E1466G	probably benign	Het
Ces3b	T	C	8: 105,092,635	F441S	probably damaging	Het
Cfap52	T	C	11: 67,926,382	T562A	possibly damaging	Het
Clca3a2	C	A	3: 144,813,898	M238I	possibly damaging	Het
Cntnap5c	A	T	17: 58,102,168	D467V	probably damaging	Het
Col7a1	T	A	9: 108,972,184		probably null	Het
Cstf1	A	G	2: 172,377,710	N247S	possibly damaging	Het
Dffb	G	T	4: 153,974,615	N68K	probably benign	Het
Duox2	C	T	2: 122,291,860	G595S	probably benign	Het
Eftud2	T	A	11: 102,864,725	I228F	probably damaging	Het
Elmo3	T	C	8: 105,309,171	V578A	probably benign	Het
Elp2	A	G	18: 24,631,471	D625G	possibly damaging	Het
Ep300	C	T	15: 81,640,128	P1386S	unknown	Het
Fam120b	A	G	17: 15,417,637	D610G	probably damaging	Het
Fastk	A	T	5: 24,442,178		probably benign	Het
Fbxl6	A	G	15: 76,537,191	S252P	probably damaging	Het
Fbxo43	T	C	15: 36,161,793	K423E	probably damaging	Het
Filip1	T	A	9: 79,819,462	E625V	possibly damaging	Het
Fkbp9	T	A	6: 56,856,378	Y283*	probably null	Het
Gigyf2	T	A	1: 87,379,015	D142E	possibly damaging	Het
Gm10142	T	C	10: 77,716,014		probably null	Het
Golga5	T	C	12: 102,476,188	V262A	probably benign	Het
Hectd4	T	C	5: 121,329,605	V2539A	probably benign	Het
Ica1	G	T	6: 8,653,632	S335*	probably null	Het
Itga1	A	T	13: 115,006,897		probably benign	Het
Itgb1	T	C	8: 128,717,685		probably benign	Het
Itpr1	G	A	6: 108,473,589	V1960I	probably benign	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kprp	C	T	3: 92,825,411	V111I	probably benign	Het
Lamc3	T	C	2: 31,940,721	I1490T	probably damaging	Het
Lcp1	A	T	14: 75,227,001	D554V	possibly damaging	Het
Lgi3	A	G	14: 70,534,698	T228A	probably benign	Het
Lipa	A	T	19: 34,501,541	F260I	probably damaging	Het
Lrriq1	C	T	10: 103,215,773	E373K	probably damaging	Het
Map6	G	A	7: 99,336,836	G649D	probably benign	Het
Mccc1	A	G	3: 35,990,047		probably null	Het
Mmp23	T	A	4: 155,652,132	T151S	probably damaging	Het
Myo1d	T	A	11: 80,674,708	N401I	probably damaging	Het
Myo9b	T	A	8: 71,321,813	S323T	probably damaging	Het
Nbn	G	T	4: 15,979,353	W446L	probably benign	Het
Nedd1	A	T	10: 92,716,265		probably benign	Het
Ngef	C	A	1: 87,487,962		probably benign	Het
Nup153	A	T	13: 46,693,936	N672K	probably benign	Het
Olfr1308	T	C	2: 111,961,016	N19S	probably benign	Het
Olfr149	T	A	9: 39,702,173	I199F	probably damaging	Het
Olfr1509	T	C	14: 52,450,512	V33A	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Palm2	T	G	4: 57,710,177	V374G	possibly damaging	Het
Pdlim3	C	A	8: 45,908,460		probably benign	Het
Pmfbp1	G	A	8: 109,541,673	E951K	probably damaging	Het
Pop1	T	A	15: 34,515,891	C548*	probably null	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ptpdc1	A	T	13: 48,585,980	N658K	probably benign	Het
Ptprk	A	C	10: 28,206,225	E63D	possibly damaging	Het
Rtf1	C	T	2: 119,732,877	R712W	probably damaging	Het
Samd7	A	C	3: 30,751,073	T2P	probably benign	Het
Sft2d1	A	G	17: 8,319,422	T52A	probably benign	Het
Slc25a26	A	G	6: 94,510,833	H91R	probably damaging	Het
Slc5a4a	A	G	10: 76,189,152	E621G	possibly damaging	Het
Slf1	A	T	13: 77,126,632	L28*	probably null	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sorcs2	G	A	5: 36,397,553		probably benign	Het
Tacc2	T	C	7: 130,751,825		probably benign	Het
Tas2r140	A	G	6: 133,055,327	V156A	possibly damaging	Het
Terf2ip	C	A	8: 112,018,164	T371K	possibly damaging	Het
Tifa	C	T	3: 127,796,888	L103F	probably damaging	Het
Tmco3	A	G	8: 13,292,037	N104D	probably damaging	Het
Tmem259	T	A	10: 79,978,963	D240V	probably damaging	Het
Trim60	C	T	8: 65,001,048	R183H	probably benign	Het
Trps1	T	C	15: 50,664,743	N725D	probably damaging	Het
Ttn	C	T	2: 76,814,806	V12902M	probably damaging	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Unc79	A	G	12: 103,112,891	K1772E	probably damaging	Het
Vwde	C	T	6: 13,193,126	V405I	probably benign	Het
Wdr18	T	A	10: 79,966,408	D290E	probably damaging	Het
Wdr92	T	C	11: 17,229,851	L284P	probably damaging	Het
Wwc2	G	A	8: 47,900,721	A126V	probably benign	Het
Zfp882	A	T	8: 71,913,523	I105F	possibly damaging	Het
Zfp942	A	T	17: 21,928,572	C359S	probably benign	Het

Other mutations in Mical3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Mical3	APN	6	120961624	missense	possibly damaging	0.73
IGL00718:Mical3	APN	6	121040449	missense	probably damaging	0.98
IGL00940:Mical3	APN	6	121022410	missense	possibly damaging	0.55
IGL00973:Mical3	APN	6	120934924	splice site	probably benign
IGL01503:Mical3	APN	6	120958576	missense	probably benign	0.09
IGL01991:Mical3	APN	6	120935211	missense	probably damaging	0.98
IGL02794:Mical3	APN	6	121007309	missense	probably damaging	0.99
IGL02996:Mical3	APN	6	120958558	missense	probably damaging	1.00
IGL03105:Mical3	APN	6	121042238	missense	probably benign	0.01
IGL03109:Mical3	APN	6	121009124	missense	probably damaging	1.00
IGL03236:Mical3	APN	6	120969384	missense	probably benign	0.00
P0028:Mical3	UTSW	6	121024689	missense	probably benign	0.33
R0494:Mical3	UTSW	6	120959201	missense	possibly damaging	0.94
R0586:Mical3	UTSW	6	121029641	unclassified	probably benign
R1029:Mical3	UTSW	6	120934678	missense	probably benign	0.02
R1263:Mical3	UTSW	6	120952469	missense	probably damaging	0.99
R1507:Mical3	UTSW	6	121042238	missense	probably benign	0.36
R1527:Mical3	UTSW	6	121024779	missense	probably damaging	0.99
R1623:Mical3	UTSW	6	121024807	missense	probably damaging	0.99
R1680:Mical3	UTSW	6	120959643	missense	probably benign	0.09
R1697:Mical3	UTSW	6	121007408	missense	possibly damaging	0.84
R1817:Mical3	UTSW	6	121042235	missense	probably benign	0.06
R1875:Mical3	UTSW	6	121042064	missense	probably damaging	1.00
R1961:Mical3	UTSW	6	120982607	missense	possibly damaging	0.94
R2004:Mical3	UTSW	6	120951322	missense	probably damaging	1.00
R2093:Mical3	UTSW	6	121040386	missense	probably damaging	1.00
R2141:Mical3	UTSW	6	121031134	splice site	probably null
R2142:Mical3	UTSW	6	121031134	splice site	probably null
R2257:Mical3	UTSW	6	121033735	missense	possibly damaging	0.94
R2404:Mical3	UTSW	6	120959828	missense	probably benign	0.01
R2419:Mical3	UTSW	6	120959923	missense	probably benign
R2509:Mical3	UTSW	6	121034157	missense	probably damaging	1.00
R3784:Mical3	UTSW	6	121021337	missense	probably benign	0.00
R4342:Mical3	UTSW	6	120934838	nonsense	probably null
R4343:Mical3	UTSW	6	120934838	nonsense	probably null
R4579:Mical3	UTSW	6	120958699	missense	probably benign
R4603:Mical3	UTSW	6	120934838	nonsense	probably null
R4605:Mical3	UTSW	6	121034080	nonsense	probably null
R4610:Mical3	UTSW	6	120934838	nonsense	probably null
R4611:Mical3	UTSW	6	120934838	nonsense	probably null
R4623:Mical3	UTSW	6	120961625	nonsense	probably null
R4669:Mical3	UTSW	6	120957703	missense	probably damaging	0.98
R4704:Mical3	UTSW	6	120958688	missense	probably benign	0.00
R4722:Mical3	UTSW	6	121038525	missense	probably benign	0.00
R4863:Mical3	UTSW	6	121033787	missense	probably damaging	0.99
R4878:Mical3	UTSW	6	120969387	missense	possibly damaging	0.51
R4885:Mical3	UTSW	6	120935253	missense	probably damaging	1.00
R4907:Mical3	UTSW	6	121007298	missense	probably benign	0.00
R5007:Mical3	UTSW	6	121038069	missense	probably damaging	0.98
R5299:Mical3	UTSW	6	120959512	missense	possibly damaging	0.71
R5303:Mical3	UTSW	6	120959980	missense	probably benign
R5368:Mical3	UTSW	6	120959473	missense	probably damaging	1.00
R5955:Mical3	UTSW	6	121033750	missense	probably damaging	0.99
R5970:Mical3	UTSW	6	120958271	nonsense	probably null
R6000:Mical3	UTSW	6	121021320	missense	probably benign	0.06
R6101:Mical3	UTSW	6	121033710	missense	probably damaging	1.00
R6195:Mical3	UTSW	6	121016835	intron	probably benign
R6210:Mical3	UTSW	6	121040517	splice site	probably null
R6225:Mical3	UTSW	6	120958723	missense	probably damaging	0.98
R6258:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6260:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6349:Mical3	UTSW	6	120959525	missense	probably benign
R6352:Mical3	UTSW	6	120952473	missense	probably damaging	0.97
R6480:Mical3	UTSW	6	121034275	missense	possibly damaging	0.76
R6704:Mical3	UTSW	6	121009800	intron	probably benign
R6783:Mical3	UTSW	6	120958825	missense	possibly damaging	0.85
R6925:Mical3	UTSW	6	120959390	missense	probably benign	0.05
R6960:Mical3	UTSW	6	120958543	missense	probably damaging	1.00
R7170:Mical3	UTSW	6	120973733	splice site	probably null
R7344:Mical3	UTSW	6	121036544	nonsense	probably null
R7414:Mical3	UTSW	6	121034113	missense	probably damaging	1.00
R7455:Mical3	UTSW	6	120958744	missense	probably damaging	1.00
R7649:Mical3	UTSW	6	120934948	missense	probably damaging	1.00
R8236:Mical3	UTSW	6	121012543	missense
R8286:Mical3	UTSW	6	121021188	missense	possibly damaging	0.68
R8316:Mical3	UTSW	6	120934983	missense	probably damaging	1.00
R8328:Mical3	UTSW	6	120935177	missense	probably damaging	0.98
R8354:Mical3	UTSW	6	120973420	missense	probably damaging	0.99
R8511:Mical3	UTSW	6	121038552	missense	possibly damaging	0.78
R8687:Mical3	UTSW	6	120959477	missense	probably benign	0.19
R8728:Mical3	UTSW	6	120973553	missense	probably damaging	0.99
R8925:Mical3	UTSW	6	121007364	missense	probably benign	0.00
R8927:Mical3	UTSW	6	121007364	missense	probably benign	0.00
R8986:Mical3	UTSW	6	121014861	missense
R9026:Mical3	UTSW	6	121009887	splice site	probably benign
R9415:Mical3	UTSW	6	120957751	missense	probably damaging	1.00
R9515:Mical3	UTSW	6	121024797	missense	probably damaging	1.00
R9720:Mical3	UTSW	6	120958277	missense	probably damaging	0.99
R9777:Mical3	UTSW	6	120982568	missense	possibly damaging	0.91
U24488:Mical3	UTSW	6	121001496	missense	possibly damaging	0.90
Z1177:Mical3	UTSW	6	120959728	missense	possibly damaging	0.71
Z1190:Mical3	UTSW	6	121021358	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCAAAGTCTGCCTGCTATGAGACC -3'
(R):5'- GAGTCGCATGTCCCCATACATGAG -3'

Sequencing Primer
(F):5'- GCCTGCTATGAGACCAGAGAG -3'
(R):5'- CCCATACATGAGCCTGATTTTGAG -3'

Posted On

2013-05-23