Incidental Mutation 'R0244:Map6'
ID 37968
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms F-STOP, Mtap6, 2810411E12Rik, STOP
MMRRC Submission 038482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R0244 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 99267447-99337137 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 99336836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 649 (G649D)
Ref Sequence ENSEMBL: ENSMUSP00000146954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably benign
Transcript: ENSMUST00000068973
AA Change: G852D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: G852D

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000207883
AA Change: G852D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably benign
Transcript: ENSMUST00000208924
AA Change: G649D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,491 probably null Het
Adamdec1 A T 14: 68,568,723 C434* probably null Het
Adprhl1 A G 8: 13,242,391 probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Arel1 T C 12: 84,920,693 T786A probably damaging Het
Arhgap26 A G 18: 39,363,131 K117R probably benign Het
Atp6v0b C T 4: 117,884,622 G204D probably damaging Het
Bace2 T A 16: 97,436,773 probably null Het
Camk4 G A 18: 33,179,625 probably null Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cep152 T C 2: 125,564,214 E1466G probably benign Het
Ces3b T C 8: 105,092,635 F441S probably damaging Het
Cfap52 T C 11: 67,926,382 T562A possibly damaging Het
Clca3a2 C A 3: 144,813,898 M238I possibly damaging Het
Cntnap5c A T 17: 58,102,168 D467V probably damaging Het
Col7a1 T A 9: 108,972,184 probably null Het
Cstf1 A G 2: 172,377,710 N247S possibly damaging Het
Dffb G T 4: 153,974,615 N68K probably benign Het
Duox2 C T 2: 122,291,860 G595S probably benign Het
Eftud2 T A 11: 102,864,725 I228F probably damaging Het
Elmo3 T C 8: 105,309,171 V578A probably benign Het
Elp2 A G 18: 24,631,471 D625G possibly damaging Het
Ep300 C T 15: 81,640,128 P1386S unknown Het
Fam120b A G 17: 15,417,637 D610G probably damaging Het
Fastk A T 5: 24,442,178 probably benign Het
Fbxl6 A G 15: 76,537,191 S252P probably damaging Het
Fbxo43 T C 15: 36,161,793 K423E probably damaging Het
Filip1 T A 9: 79,819,462 E625V possibly damaging Het
Fkbp9 T A 6: 56,856,378 Y283* probably null Het
Gigyf2 T A 1: 87,379,015 D142E possibly damaging Het
Gm10142 T C 10: 77,716,014 probably null Het
Golga5 T C 12: 102,476,188 V262A probably benign Het
Hectd4 T C 5: 121,329,605 V2539A probably benign Het
Ica1 G T 6: 8,653,632 S335* probably null Het
Itga1 A T 13: 115,006,897 probably benign Het
Itgb1 T C 8: 128,717,685 probably benign Het
Itpr1 G A 6: 108,473,589 V1960I probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kprp C T 3: 92,825,411 V111I probably benign Het
Lamc3 T C 2: 31,940,721 I1490T probably damaging Het
Lcp1 A T 14: 75,227,001 D554V possibly damaging Het
Lgi3 A G 14: 70,534,698 T228A probably benign Het
Lipa A T 19: 34,501,541 F260I probably damaging Het
Lrriq1 C T 10: 103,215,773 E373K probably damaging Het
Mccc1 A G 3: 35,990,047 probably null Het
Mical3 A T 6: 120,957,722 S1799T probably benign Het
Mmp23 T A 4: 155,652,132 T151S probably damaging Het
Myo1d T A 11: 80,674,708 N401I probably damaging Het
Myo9b T A 8: 71,321,813 S323T probably damaging Het
Nbn G T 4: 15,979,353 W446L probably benign Het
Nedd1 A T 10: 92,716,265 probably benign Het
Ngef C A 1: 87,487,962 probably benign Het
Nup153 A T 13: 46,693,936 N672K probably benign Het
Olfr1308 T C 2: 111,961,016 N19S probably benign Het
Olfr149 T A 9: 39,702,173 I199F probably damaging Het
Olfr1509 T C 14: 52,450,512 V33A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Palm2 T G 4: 57,710,177 V374G possibly damaging Het
Pdlim3 C A 8: 45,908,460 probably benign Het
Pmfbp1 G A 8: 109,541,673 E951K probably damaging Het
Pop1 T A 15: 34,515,891 C548* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ptpdc1 A T 13: 48,585,980 N658K probably benign Het
Ptprk A C 10: 28,206,225 E63D possibly damaging Het
Rtf1 C T 2: 119,732,877 R712W probably damaging Het
Samd7 A C 3: 30,751,073 T2P probably benign Het
Sft2d1 A G 17: 8,319,422 T52A probably benign Het
Slc25a26 A G 6: 94,510,833 H91R probably damaging Het
Slc5a4a A G 10: 76,189,152 E621G possibly damaging Het
Slf1 A T 13: 77,126,632 L28* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorcs2 G A 5: 36,397,553 probably benign Het
Tacc2 T C 7: 130,751,825 probably benign Het
Tas2r140 A G 6: 133,055,327 V156A possibly damaging Het
Terf2ip C A 8: 112,018,164 T371K possibly damaging Het
Tifa C T 3: 127,796,888 L103F probably damaging Het
Tmco3 A G 8: 13,292,037 N104D probably damaging Het
Tmem259 T A 10: 79,978,963 D240V probably damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Trps1 T C 15: 50,664,743 N725D probably damaging Het
Ttn C T 2: 76,814,806 V12902M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Unc79 A G 12: 103,112,891 K1772E probably damaging Het
Vwde C T 6: 13,193,126 V405I probably benign Het
Wdr18 T A 10: 79,966,408 D290E probably damaging Het
Wdr92 T C 11: 17,229,851 L284P probably damaging Het
Wwc2 G A 8: 47,900,721 A126V probably benign Het
Zfp882 A T 8: 71,913,523 I105F possibly damaging Het
Zfp942 A T 17: 21,928,572 C359S probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0118:Map6 UTSW 7 99317617 missense possibly damaging 0.53
R0125:Map6 UTSW 7 99335980 splice site probably null
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0974:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R1455:Map6 UTSW 7 99268214 missense probably damaging 1.00
R1678:Map6 UTSW 7 99268098 missense probably damaging 1.00
R1696:Map6 UTSW 7 99317457 splice site probably null
R1866:Map6 UTSW 7 99315876 missense probably damaging 1.00
R2061:Map6 UTSW 7 99317472 missense probably damaging 1.00
R3236:Map6 UTSW 7 99336824 missense probably damaging 1.00
R3625:Map6 UTSW 7 99269195 missense possibly damaging 0.60
R4044:Map6 UTSW 7 99268049 missense probably damaging 1.00
R4570:Map6 UTSW 7 99336556 missense possibly damaging 0.49
R5056:Map6 UTSW 7 99336652 missense probably benign 0.05
R5065:Map6 UTSW 7 99336710 missense probably benign 0.02
R5656:Map6 UTSW 7 99336298 missense probably damaging 1.00
R6101:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6105:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6302:Map6 UTSW 7 99336107 missense probably damaging 0.99
R6450:Map6 UTSW 7 99268038 missense probably damaging 1.00
R6915:Map6 UTSW 7 99268247 missense probably damaging 1.00
R7205:Map6 UTSW 7 99269050 missense probably benign 0.00
R7223:Map6 UTSW 7 99268025 missense probably damaging 1.00
R7293:Map6 UTSW 7 99336533 missense possibly damaging 0.49
R7481:Map6 UTSW 7 99269138 missense possibly damaging 0.57
R7489:Map6 UTSW 7 99268061 missense probably damaging 1.00
R7691:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7693:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7695:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R8341:Map6 UTSW 7 99268440 missense possibly damaging 0.75
R8865:Map6 UTSW 7 99268985 missense probably benign 0.37
R8953:Map6 UTSW 7 99315871 missense probably damaging 1.00
R9108:Map6 UTSW 7 99336896 missense probably damaging 1.00
R9173:Map6 UTSW 7 99268728 missense probably damaging 1.00
R9613:Map6 UTSW 7 99269177 missense possibly damaging 0.90
R9654:Map6 UTSW 7 99336959 missense probably damaging 1.00
Z1176:Map6 UTSW 7 99317660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGAAGAACCAAGGTCCAGTG -3'
(R):5'- ACTTTGCCTCCCCAGAAGGGAAAC -3'

Sequencing Primer
(F):5'- AAGGTCCAGTGATCCCTGAG -3'
(R):5'- CATGGCATTTCAGGGCAATC -3'
Posted On 2013-05-23