Incidental Mutation 'R4913:Lmod3'
ID 379697
Institutional Source Beutler Lab
Gene Symbol Lmod3
Ensembl Gene ENSMUSG00000044086
Gene Name leiomodin 3 (fetal)
Synonyms 5430424A14Rik
MMRRC Submission 042515-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R4913 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 97215495-97229720 bp(-) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to G at 97224125 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095655]
AlphaFold E9QA62
Predicted Effect probably null
Transcript: ENSMUST00000095655
SMART Domains Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086

DomainStartEndE-ValueType
Pfam:Tropomodulin 8 177 1.2e-13 PFAM
PDB:1IO0|A 248 406 9e-46 PDB
SCOP:d1a4ya_ 261 358 1e-3 SMART
low complexity region 407 427 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm1 T A 4: 144,255,381 (GRCm39) M267K possibly damaging Het
Acsm5 T C 7: 119,133,566 (GRCm39) S244P probably damaging Het
Actr6 A G 10: 89,550,808 (GRCm39) F329L probably benign Het
Actrt3 A G 3: 30,652,588 (GRCm39) S169P probably benign Het
Agtpbp1 C A 13: 59,647,886 (GRCm39) G645C probably damaging Het
AI661453 C T 17: 47,779,480 (GRCm39) R1069* probably null Het
Akr1c6 T C 13: 4,504,524 (GRCm39) I303T probably benign Het
Arnt A G 3: 95,397,965 (GRCm39) R588G probably damaging Het
Atf1 A G 15: 100,149,979 (GRCm39) probably null Het
Casp12 T C 9: 5,358,726 (GRCm39) V318A probably damaging Het
Cblb C T 16: 51,986,392 (GRCm39) P545L possibly damaging Het
Cc2d2a A T 5: 43,896,665 (GRCm39) I1521F probably benign Het
Ccn2 T C 10: 24,473,225 (GRCm39) C255R probably damaging Het
Ccnb1ip1 T A 14: 51,029,601 (GRCm39) K154* probably null Het
Cd300a A T 11: 114,784,198 (GRCm39) K69* probably null Het
Cdin1 A G 2: 115,500,568 (GRCm39) probably null Het
Clec10a A G 11: 70,060,851 (GRCm39) Y78C probably damaging Het
Cnot1 T C 8: 96,489,695 (GRCm39) I503V possibly damaging Het
Cpa2 A G 6: 30,554,292 (GRCm39) H304R probably damaging Het
Crb2 A T 2: 37,680,257 (GRCm39) H395L probably benign Het
Dnah8 T A 17: 31,038,113 (GRCm39) N4257K probably damaging Het
Dnase2a G A 8: 85,635,477 (GRCm39) D25N probably damaging Het
Drd1 T C 13: 54,207,186 (GRCm39) T343A probably benign Het
Emid1 G A 11: 5,082,012 (GRCm39) T161I probably benign Het
Epn2 A G 11: 61,425,402 (GRCm39) probably null Het
Esp36 A T 17: 38,728,055 (GRCm39) N75K possibly damaging Het
Faf1 A G 4: 109,792,746 (GRCm39) S573G possibly damaging Het
Fam149a T G 8: 45,806,920 (GRCm39) S231R probably damaging Het
Fam78a T C 2: 31,959,774 (GRCm39) E112G probably damaging Het
Fgf18 T C 11: 33,084,316 (GRCm39) D46G probably benign Het
Fggy G A 4: 95,585,313 (GRCm39) probably null Het
Foxb1 T C 9: 69,666,859 (GRCm39) M224V probably benign Het
Gpr75 T C 11: 30,841,808 (GRCm39) C238R possibly damaging Het
Gsdmc3 A G 15: 63,730,122 (GRCm39) *481R probably null Het
H2az2 C A 11: 6,383,750 (GRCm39) A57S probably damaging Het
Hsd17b11 T C 5: 104,140,748 (GRCm39) I250V probably benign Het
Hus1 C A 11: 8,946,856 (GRCm39) L280F probably benign Het
Ide A T 19: 37,306,469 (GRCm39) H101Q unknown Het
Ido1 T C 8: 25,074,533 (GRCm39) D279G probably benign Het
Inpp5b T C 4: 124,674,214 (GRCm39) V307A probably benign Het
Ipo5 G A 14: 121,172,498 (GRCm39) V519I probably damaging Het
Krba1 T C 6: 48,383,891 (GRCm39) V239A probably benign Het
Macf1 T C 4: 123,393,682 (GRCm39) D836G probably damaging Het
Malt1 G T 18: 65,609,351 (GRCm39) C774F probably damaging Het
Map2k4 C A 11: 65,600,758 (GRCm39) D58Y probably damaging Het
Mc2r T C 18: 68,540,411 (GRCm39) N294S probably benign Het
Mybpc1 A G 10: 88,389,116 (GRCm39) probably null Het
Mybpc3 A G 2: 90,956,609 (GRCm39) E637G possibly damaging Het
Narf A G 11: 121,135,469 (GRCm39) Q107R probably damaging Het
Nlrp3 G A 11: 59,440,064 (GRCm39) G547D probably benign Het
Nucb2 G T 7: 116,123,540 (GRCm39) G51* probably null Het
Or10al5 T A 17: 38,063,315 (GRCm39) V190D possibly damaging Het
Otog C A 7: 45,913,526 (GRCm39) D786E probably benign Het
Otogl T C 10: 107,712,716 (GRCm39) T543A probably damaging Het
Pgap6 T C 17: 26,339,513 (GRCm39) F584L probably damaging Het
Phf20l1 A G 15: 66,476,704 (GRCm39) N266S probably benign Het
Pink1 G T 4: 138,042,866 (GRCm39) S446* probably null Het
Pkp4 T G 2: 59,135,794 (GRCm39) H186Q probably damaging Het
Prl3b1 T C 13: 27,433,460 (GRCm39) V205A probably damaging Het
Prss32 T C 17: 24,078,157 (GRCm39) V281A probably damaging Het
Psd3 C T 8: 68,573,821 (GRCm39) C120Y probably damaging Het
Ptcra A G 17: 47,069,574 (GRCm39) L99P probably damaging Het
Rab3gap2 C T 1: 184,995,026 (GRCm39) T855I probably benign Het
Rabgap1l T C 1: 160,066,111 (GRCm39) E199G probably damaging Het
Rbm44 T A 1: 91,083,216 (GRCm39) C580S probably damaging Het
Resf1 C G 6: 149,230,887 (GRCm39) S1311C probably damaging Het
Rhoq T C 17: 87,302,493 (GRCm39) V143A probably benign Het
Sacs T A 14: 61,451,246 (GRCm39) Y4431N probably benign Het
Sec24b A T 3: 129,796,028 (GRCm39) S367T probably benign Het
Sema4c G A 1: 36,589,266 (GRCm39) S620F probably benign Het
Slc12a1 G A 2: 125,070,670 (GRCm39) G1054E probably damaging Het
Slc16a3 A G 11: 120,848,794 (GRCm39) R417G probably benign Het
Slc22a29 A T 19: 8,195,722 (GRCm39) S106T probably benign Het
Slc41a2 T C 10: 83,149,284 (GRCm39) T220A probably damaging Het
Tap1 T C 17: 34,412,468 (GRCm39) F474L possibly damaging Het
Tas2r106 G T 6: 131,655,422 (GRCm39) A143D probably benign Het
Tbx6 A T 7: 126,383,707 (GRCm39) probably null Het
Tfap2a T A 13: 40,870,706 (GRCm39) N402I probably damaging Het
Tle3 T A 9: 61,281,275 (GRCm39) V22E probably damaging Het
Trip4 T C 9: 65,765,639 (GRCm39) I353M probably damaging Het
Ubr2 C A 17: 47,270,385 (GRCm39) probably null Het
Ugdh A G 5: 65,580,791 (GRCm39) probably null Het
Uhrf1 T C 17: 56,622,478 (GRCm39) V431A probably damaging Het
Usp5 C G 6: 124,799,593 (GRCm39) K318N possibly damaging Het
Zfp820 T C 17: 22,038,200 (GRCm39) K376R probably benign Het
Other mutations in Lmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmod3 APN 6 97,229,258 (GRCm39) missense probably damaging 0.99
IGL00465:Lmod3 APN 6 97,224,822 (GRCm39) missense probably damaging 1.00
IGL01401:Lmod3 APN 6 97,229,513 (GRCm39) missense probably damaging 1.00
IGL02279:Lmod3 APN 6 97,224,633 (GRCm39) missense probably damaging 1.00
IGL02621:Lmod3 APN 6 97,215,796 (GRCm39) utr 3 prime probably benign
IGL03116:Lmod3 APN 6 97,224,156 (GRCm39) missense possibly damaging 0.92
Runted UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R0086:Lmod3 UTSW 6 97,224,306 (GRCm39) missense probably damaging 1.00
R0627:Lmod3 UTSW 6 97,225,032 (GRCm39) missense probably damaging 0.96
R2208:Lmod3 UTSW 6 97,224,838 (GRCm39) missense probably benign 0.06
R4038:Lmod3 UTSW 6 97,225,275 (GRCm39) missense probably benign 0.06
R5867:Lmod3 UTSW 6 97,224,963 (GRCm39) missense probably damaging 1.00
R5905:Lmod3 UTSW 6 97,224,575 (GRCm39) missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R6183:Lmod3 UTSW 6 97,229,514 (GRCm39) missense probably damaging 1.00
R6210:Lmod3 UTSW 6 97,224,262 (GRCm39) missense probably damaging 1.00
R6527:Lmod3 UTSW 6 97,224,339 (GRCm39) missense probably benign 0.00
R7225:Lmod3 UTSW 6 97,224,345 (GRCm39) missense probably benign 0.34
R7531:Lmod3 UTSW 6 97,225,403 (GRCm39) missense probably benign 0.01
R7908:Lmod3 UTSW 6 97,225,434 (GRCm39) missense probably benign 0.05
R8022:Lmod3 UTSW 6 97,225,260 (GRCm39) missense probably benign
R8154:Lmod3 UTSW 6 97,224,941 (GRCm39) missense probably damaging 1.00
R8325:Lmod3 UTSW 6 97,224,379 (GRCm39) missense probably benign 0.06
R9149:Lmod3 UTSW 6 97,224,625 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGACCTCCCGGTGTTAAAC -3'
(R):5'- AATCTCGAATGCCGGAAGC -3'

Sequencing Primer
(F):5'- GACCTCCCGGTGTTAAACTAATGG -3'
(R):5'- TCGAATGCCGGAAGCCAGAG -3'
Posted On 2016-04-15