Incidental Mutation 'R4913:Otog'
ID379701
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
MMRRC Submission 042515-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R4913 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46264102 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 786 (D786E)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
Predicted Effect probably benign
Transcript: ENSMUST00000164538
AA Change: D786E

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: D786E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210281
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
9430007A20Rik T A 4: 144,528,811 M267K possibly damaging Het
Acsm5 T C 7: 119,534,343 S244P probably damaging Het
Actr6 A G 10: 89,714,946 F329L probably benign Het
Actrt3 A G 3: 30,598,439 S169P probably benign Het
Agtpbp1 C A 13: 59,500,072 G645C probably damaging Het
AI661453 C T 17: 47,468,555 R1069* probably null Het
Akr1c6 T C 13: 4,454,525 I303T probably benign Het
Arnt A G 3: 95,490,654 R588G probably damaging Het
Atf1 A G 15: 100,252,098 probably null Het
BC052040 A G 2: 115,670,087 probably null Het
Casp12 T C 9: 5,358,726 V318A probably damaging Het
Cblb C T 16: 52,166,029 P545L possibly damaging Het
Cc2d2a A T 5: 43,739,323 I1521F probably benign Het
Ccnb1ip1 T A 14: 50,792,144 K154* probably null Het
Cd300a A T 11: 114,893,372 K69* probably null Het
Clec10a A G 11: 70,170,025 Y78C probably damaging Het
Cnot1 T C 8: 95,763,067 I503V possibly damaging Het
Cpa2 A G 6: 30,554,293 H304R probably damaging Het
Crb2 A T 2: 37,790,245 H395L probably benign Het
Ctgf T C 10: 24,597,327 C255R probably damaging Het
Dnah8 T A 17: 30,819,139 N4257K probably damaging Het
Dnase2a G A 8: 84,908,848 D25N probably damaging Het
Drd1 T C 13: 54,053,167 T343A probably benign Het
Emid1 G A 11: 5,132,012 T161I probably benign Het
Epn2 A G 11: 61,534,576 probably null Het
Esp36 A T 17: 38,417,164 N75K possibly damaging Het
Faf1 A G 4: 109,935,549 S573G possibly damaging Het
Fam149a T G 8: 45,353,883 S231R probably damaging Het
Fam78a T C 2: 32,069,762 E112G probably damaging Het
Fgf18 T C 11: 33,134,316 D46G probably benign Het
Fggy G A 4: 95,697,076 probably null Het
Foxb1 T C 9: 69,759,577 M224V probably benign Het
Gpr75 T C 11: 30,891,808 C238R possibly damaging Het
Gsdmc3 A G 15: 63,858,273 *481R probably null Het
H2afv C A 11: 6,433,750 A57S probably damaging Het
Hsd17b11 T C 5: 103,992,882 I250V probably benign Het
Hus1 C A 11: 8,996,856 L280F probably benign Het
Ide A T 19: 37,329,070 H101Q unknown Het
Ido1 T C 8: 24,584,517 D279G probably benign Het
Inpp5b T C 4: 124,780,421 V307A probably benign Het
Ipo5 G A 14: 120,935,086 V519I probably damaging Het
Krba1 T C 6: 48,406,957 V239A probably benign Het
Lmod3 A G 6: 97,247,164 probably null Het
Macf1 T C 4: 123,499,889 D836G probably damaging Het
Malt1 G T 18: 65,476,280 C774F probably damaging Het
Map2k4 C A 11: 65,709,932 D58Y probably damaging Het
Mc2r T C 18: 68,407,340 N294S probably benign Het
Mybpc1 A G 10: 88,553,254 probably null Het
Mybpc3 A G 2: 91,126,264 E637G possibly damaging Het
Narf A G 11: 121,244,643 Q107R probably damaging Het
Nlrp3 G A 11: 59,549,238 G547D probably benign Het
Nucb2 G T 7: 116,524,305 G51* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Otogl T C 10: 107,876,855 T543A probably damaging Het
Phf20l1 A G 15: 66,604,855 N266S probably benign Het
Pink1 G T 4: 138,315,555 S446* probably null Het
Pkp4 T G 2: 59,305,450 H186Q probably damaging Het
Prl3b1 T C 13: 27,249,477 V205A probably damaging Het
Prss32 T C 17: 23,859,183 V281A probably damaging Het
Psd3 C T 8: 68,121,169 C120Y probably damaging Het
Ptcra A G 17: 46,758,648 L99P probably damaging Het
Rab3gap2 C T 1: 185,262,829 T855I probably benign Het
Rabgap1l T C 1: 160,238,541 E199G probably damaging Het
Rbm44 T A 1: 91,155,494 C580S probably damaging Het
Rhoq T C 17: 86,995,065 V143A probably benign Het
Sacs T A 14: 61,213,797 Y4431N probably benign Het
Sec24b A T 3: 130,002,379 S367T probably benign Het
Sema4c G A 1: 36,550,185 S620F probably benign Het
Slc12a1 G A 2: 125,228,750 G1054E probably damaging Het
Slc16a3 A G 11: 120,957,968 R417G probably benign Het
Slc22a29 A T 19: 8,218,358 S106T probably benign Het
Slc41a2 T C 10: 83,313,420 T220A probably damaging Het
Tap1 T C 17: 34,193,494 F474L possibly damaging Het
Tas2r106 G T 6: 131,678,459 A143D probably benign Het
Tbx6 A T 7: 126,784,535 probably null Het
Tfap2a T A 13: 40,717,230 N402I probably damaging Het
Tle3 T A 9: 61,373,993 V22E probably damaging Het
Tmem8 T C 17: 26,120,539 F584L probably damaging Het
Trip4 T C 9: 65,858,357 I353M probably damaging Het
Ubr2 C A 17: 46,959,459 probably null Het
Ugdh A G 5: 65,423,448 probably null Het
Uhrf1 T C 17: 56,315,478 V431A probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zfp820 T C 17: 21,819,219 K376R probably benign Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7468:Otog UTSW 7 46264119 missense probably benign
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
R7502:Otog UTSW 7 46298615 missense probably damaging 1.00
R7558:Otog UTSW 7 46303160 missense probably damaging 0.99
R7577:Otog UTSW 7 46287855 missense possibly damaging 0.62
R7651:Otog UTSW 7 46241761 missense probably benign 0.00
R7689:Otog UTSW 7 46252056 missense probably damaging 1.00
R7806:Otog UTSW 7 46285776 missense probably benign
RF024:Otog UTSW 7 46287669 missense probably damaging 1.00
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACTTCTTTGACCCTGG -3'
(R):5'- ACTTGCCTCTCCCAACAAGG -3'

Sequencing Primer
(F):5'- GGGACAGGGCAAATCTCTTACC -3'
(R):5'- AACAAGGCCTGCATGCTG -3'
Posted On2016-04-15