Incidental Mutation 'R4913:Mybpc1'
ID 379717
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Name myosin binding protein C, slow-type
Synonyms Slow-type C-protein, 8030451F13Rik
MMRRC Submission 042515-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R4913 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 88354141-88441014 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 88389116 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
AlphaFold A0A571BEN1
Predicted Effect probably null
Transcript: ENSMUST00000119185
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121629
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156573
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm1 T A 4: 144,255,381 (GRCm39) M267K possibly damaging Het
Acsm5 T C 7: 119,133,566 (GRCm39) S244P probably damaging Het
Actr6 A G 10: 89,550,808 (GRCm39) F329L probably benign Het
Actrt3 A G 3: 30,652,588 (GRCm39) S169P probably benign Het
Agtpbp1 C A 13: 59,647,886 (GRCm39) G645C probably damaging Het
AI661453 C T 17: 47,779,480 (GRCm39) R1069* probably null Het
Akr1c6 T C 13: 4,504,524 (GRCm39) I303T probably benign Het
Arnt A G 3: 95,397,965 (GRCm39) R588G probably damaging Het
Atf1 A G 15: 100,149,979 (GRCm39) probably null Het
Casp12 T C 9: 5,358,726 (GRCm39) V318A probably damaging Het
Cblb C T 16: 51,986,392 (GRCm39) P545L possibly damaging Het
Cc2d2a A T 5: 43,896,665 (GRCm39) I1521F probably benign Het
Ccn2 T C 10: 24,473,225 (GRCm39) C255R probably damaging Het
Ccnb1ip1 T A 14: 51,029,601 (GRCm39) K154* probably null Het
Cd300a A T 11: 114,784,198 (GRCm39) K69* probably null Het
Cdin1 A G 2: 115,500,568 (GRCm39) probably null Het
Clec10a A G 11: 70,060,851 (GRCm39) Y78C probably damaging Het
Cnot1 T C 8: 96,489,695 (GRCm39) I503V possibly damaging Het
Cpa2 A G 6: 30,554,292 (GRCm39) H304R probably damaging Het
Crb2 A T 2: 37,680,257 (GRCm39) H395L probably benign Het
Dnah8 T A 17: 31,038,113 (GRCm39) N4257K probably damaging Het
Dnase2a G A 8: 85,635,477 (GRCm39) D25N probably damaging Het
Drd1 T C 13: 54,207,186 (GRCm39) T343A probably benign Het
Emid1 G A 11: 5,082,012 (GRCm39) T161I probably benign Het
Epn2 A G 11: 61,425,402 (GRCm39) probably null Het
Esp36 A T 17: 38,728,055 (GRCm39) N75K possibly damaging Het
Faf1 A G 4: 109,792,746 (GRCm39) S573G possibly damaging Het
Fam149a T G 8: 45,806,920 (GRCm39) S231R probably damaging Het
Fam78a T C 2: 31,959,774 (GRCm39) E112G probably damaging Het
Fgf18 T C 11: 33,084,316 (GRCm39) D46G probably benign Het
Fggy G A 4: 95,585,313 (GRCm39) probably null Het
Foxb1 T C 9: 69,666,859 (GRCm39) M224V probably benign Het
Gpr75 T C 11: 30,841,808 (GRCm39) C238R possibly damaging Het
Gsdmc3 A G 15: 63,730,122 (GRCm39) *481R probably null Het
H2az2 C A 11: 6,383,750 (GRCm39) A57S probably damaging Het
Hsd17b11 T C 5: 104,140,748 (GRCm39) I250V probably benign Het
Hus1 C A 11: 8,946,856 (GRCm39) L280F probably benign Het
Ide A T 19: 37,306,469 (GRCm39) H101Q unknown Het
Ido1 T C 8: 25,074,533 (GRCm39) D279G probably benign Het
Inpp5b T C 4: 124,674,214 (GRCm39) V307A probably benign Het
Ipo5 G A 14: 121,172,498 (GRCm39) V519I probably damaging Het
Krba1 T C 6: 48,383,891 (GRCm39) V239A probably benign Het
Lmod3 A G 6: 97,224,125 (GRCm39) probably null Het
Macf1 T C 4: 123,393,682 (GRCm39) D836G probably damaging Het
Malt1 G T 18: 65,609,351 (GRCm39) C774F probably damaging Het
Map2k4 C A 11: 65,600,758 (GRCm39) D58Y probably damaging Het
Mc2r T C 18: 68,540,411 (GRCm39) N294S probably benign Het
Mybpc3 A G 2: 90,956,609 (GRCm39) E637G possibly damaging Het
Narf A G 11: 121,135,469 (GRCm39) Q107R probably damaging Het
Nlrp3 G A 11: 59,440,064 (GRCm39) G547D probably benign Het
Nucb2 G T 7: 116,123,540 (GRCm39) G51* probably null Het
Or10al5 T A 17: 38,063,315 (GRCm39) V190D possibly damaging Het
Otog C A 7: 45,913,526 (GRCm39) D786E probably benign Het
Otogl T C 10: 107,712,716 (GRCm39) T543A probably damaging Het
Pgap6 T C 17: 26,339,513 (GRCm39) F584L probably damaging Het
Phf20l1 A G 15: 66,476,704 (GRCm39) N266S probably benign Het
Pink1 G T 4: 138,042,866 (GRCm39) S446* probably null Het
Pkp4 T G 2: 59,135,794 (GRCm39) H186Q probably damaging Het
Prl3b1 T C 13: 27,433,460 (GRCm39) V205A probably damaging Het
Prss32 T C 17: 24,078,157 (GRCm39) V281A probably damaging Het
Psd3 C T 8: 68,573,821 (GRCm39) C120Y probably damaging Het
Ptcra A G 17: 47,069,574 (GRCm39) L99P probably damaging Het
Rab3gap2 C T 1: 184,995,026 (GRCm39) T855I probably benign Het
Rabgap1l T C 1: 160,066,111 (GRCm39) E199G probably damaging Het
Rbm44 T A 1: 91,083,216 (GRCm39) C580S probably damaging Het
Resf1 C G 6: 149,230,887 (GRCm39) S1311C probably damaging Het
Rhoq T C 17: 87,302,493 (GRCm39) V143A probably benign Het
Sacs T A 14: 61,451,246 (GRCm39) Y4431N probably benign Het
Sec24b A T 3: 129,796,028 (GRCm39) S367T probably benign Het
Sema4c G A 1: 36,589,266 (GRCm39) S620F probably benign Het
Slc12a1 G A 2: 125,070,670 (GRCm39) G1054E probably damaging Het
Slc16a3 A G 11: 120,848,794 (GRCm39) R417G probably benign Het
Slc22a29 A T 19: 8,195,722 (GRCm39) S106T probably benign Het
Slc41a2 T C 10: 83,149,284 (GRCm39) T220A probably damaging Het
Tap1 T C 17: 34,412,468 (GRCm39) F474L possibly damaging Het
Tas2r106 G T 6: 131,655,422 (GRCm39) A143D probably benign Het
Tbx6 A T 7: 126,383,707 (GRCm39) probably null Het
Tfap2a T A 13: 40,870,706 (GRCm39) N402I probably damaging Het
Tle3 T A 9: 61,281,275 (GRCm39) V22E probably damaging Het
Trip4 T C 9: 65,765,639 (GRCm39) I353M probably damaging Het
Ubr2 C A 17: 47,270,385 (GRCm39) probably null Het
Ugdh A G 5: 65,580,791 (GRCm39) probably null Het
Uhrf1 T C 17: 56,622,478 (GRCm39) V431A probably damaging Het
Usp5 C G 6: 124,799,593 (GRCm39) K318N possibly damaging Het
Zfp820 T C 17: 22,038,200 (GRCm39) K376R probably benign Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88,385,124 (GRCm39) missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88,372,246 (GRCm39) missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88,360,970 (GRCm39) splice site probably null
IGL00964:Mybpc1 APN 10 88,391,604 (GRCm39) critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88,406,507 (GRCm39) missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88,367,632 (GRCm39) missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88,372,290 (GRCm39) missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88,362,235 (GRCm39) missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88,376,822 (GRCm39) missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88,407,378 (GRCm39) splice site probably benign
R1321:Mybpc1 UTSW 10 88,406,463 (GRCm39) missense probably damaging 1.00
R1321:Mybpc1 UTSW 10 88,365,403 (GRCm39) missense possibly damaging 0.85
R1562:Mybpc1 UTSW 10 88,389,193 (GRCm39) missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88,389,157 (GRCm39) missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88,384,688 (GRCm39) missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88,387,404 (GRCm39) missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88,381,921 (GRCm39) missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88,409,299 (GRCm39) nonsense probably null
R2129:Mybpc1 UTSW 10 88,387,314 (GRCm39) missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88,376,804 (GRCm39) splice site probably benign
R2200:Mybpc1 UTSW 10 88,391,557 (GRCm39) missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88,391,540 (GRCm39) missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88,387,269 (GRCm39) missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88,367,641 (GRCm39) missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88,406,521 (GRCm39) splice site probably null
R4032:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88,409,387 (GRCm39) nonsense probably null
R4821:Mybpc1 UTSW 10 88,384,727 (GRCm39) missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R4876:Mybpc1 UTSW 10 88,358,853 (GRCm39) missense probably benign
R4878:Mybpc1 UTSW 10 88,387,292 (GRCm39) missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88,391,586 (GRCm39) nonsense probably null
R4964:Mybpc1 UTSW 10 88,391,525 (GRCm39) missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88,379,636 (GRCm39) missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88,381,926 (GRCm39) missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88,372,213 (GRCm39) missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88,358,876 (GRCm39) missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88,381,891 (GRCm39) missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88,406,428 (GRCm39) missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88,378,318 (GRCm39) missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88,404,481 (GRCm39) missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88,396,217 (GRCm39) missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88,389,139 (GRCm39) missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88,358,861 (GRCm39) missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88,372,243 (GRCm39) missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88,378,192 (GRCm39) nonsense probably null
R6972:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88,358,886 (GRCm39) missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88,389,274 (GRCm39) missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88,379,581 (GRCm39) missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88,385,209 (GRCm39) missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88,362,155 (GRCm39) missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88,385,187 (GRCm39) missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88,384,716 (GRCm39) missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88,378,234 (GRCm39) missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88,394,529 (GRCm39) missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88,358,865 (GRCm39) missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88,394,553 (GRCm39) missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88,409,359 (GRCm39) nonsense probably null
R8494:Mybpc1 UTSW 10 88,362,291 (GRCm39) missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88,407,447 (GRCm39) missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88,394,437 (GRCm39) missense probably benign 0.44
R9031:Mybpc1 UTSW 10 88,358,906 (GRCm39) missense probably damaging 0.99
R9061:Mybpc1 UTSW 10 88,391,501 (GRCm39) missense probably damaging 1.00
R9081:Mybpc1 UTSW 10 88,389,168 (GRCm39) missense probably damaging 1.00
R9172:Mybpc1 UTSW 10 88,379,615 (GRCm39) missense possibly damaging 0.93
R9323:Mybpc1 UTSW 10 88,360,829 (GRCm39) critical splice donor site probably null
R9460:Mybpc1 UTSW 10 88,372,197 (GRCm39) missense probably damaging 0.99
R9488:Mybpc1 UTSW 10 88,379,624 (GRCm39) missense possibly damaging 0.47
R9757:Mybpc1 UTSW 10 88,372,257 (GRCm39) missense probably damaging 1.00
R9796:Mybpc1 UTSW 10 88,406,497 (GRCm39) missense possibly damaging 0.56
Z1176:Mybpc1 UTSW 10 88,396,189 (GRCm39) missense probably benign
Z1177:Mybpc1 UTSW 10 88,409,299 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTATTAAACCAAGCAGTTGATTCC -3'
(R):5'- TAGGAACCTTGAAGACTCTGC -3'

Sequencing Primer
(F):5'- GCAGTTGATTCCTTTCTAAGAGACC -3'
(R):5'- CCCTGTAAATCCATGTTAATTCAGG -3'
Posted On 2016-04-15