Incidental Mutation 'R4913:Fgf18'
ID379724
Institutional Source Beutler Lab
Gene Symbol Fgf18
Ensembl Gene ENSMUSG00000057967
Gene Namefibroblast growth factor 18
SynonymsD130055P09Rik, FGF-18
MMRRC Submission 042515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4913 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location33117430-33147400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33134316 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 46 (D46G)
Ref Sequence ENSEMBL: ENSMUSP00000020507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020507] [ENSMUST00000109363]
Predicted Effect probably benign
Transcript: ENSMUST00000020507
AA Change: D46G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020507
Gene: ENSMUSG00000057967
AA Change: D46G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FGF 51 178 1.29e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109363
SMART Domains Protein: ENSMUSP00000104987
Gene: ENSMUSG00000057967

DomainStartEndE-ValueType
Pfam:FGF 1 66 1.3e-22 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that this protein is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Knockout studies of the similar gene in mice implied the role of this protein in regulating proliferation and differentiation of midline cerebellar structures. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die perinatally and exhibit impaired proliferation and differentiation of osteoblasts, shortened and thickened long bones, and delayed ossification of the calvarium and long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
9430007A20Rik T A 4: 144,528,811 M267K possibly damaging Het
Acsm5 T C 7: 119,534,343 S244P probably damaging Het
Actr6 A G 10: 89,714,946 F329L probably benign Het
Actrt3 A G 3: 30,598,439 S169P probably benign Het
Agtpbp1 C A 13: 59,500,072 G645C probably damaging Het
AI661453 C T 17: 47,468,555 R1069* probably null Het
Akr1c6 T C 13: 4,454,525 I303T probably benign Het
Arnt A G 3: 95,490,654 R588G probably damaging Het
Atf1 A G 15: 100,252,098 probably null Het
BC052040 A G 2: 115,670,087 probably null Het
Casp12 T C 9: 5,358,726 V318A probably damaging Het
Cblb C T 16: 52,166,029 P545L possibly damaging Het
Cc2d2a A T 5: 43,739,323 I1521F probably benign Het
Ccnb1ip1 T A 14: 50,792,144 K154* probably null Het
Cd300a A T 11: 114,893,372 K69* probably null Het
Clec10a A G 11: 70,170,025 Y78C probably damaging Het
Cnot1 T C 8: 95,763,067 I503V possibly damaging Het
Cpa2 A G 6: 30,554,293 H304R probably damaging Het
Crb2 A T 2: 37,790,245 H395L probably benign Het
Ctgf T C 10: 24,597,327 C255R probably damaging Het
Dnah8 T A 17: 30,819,139 N4257K probably damaging Het
Dnase2a G A 8: 84,908,848 D25N probably damaging Het
Drd1 T C 13: 54,053,167 T343A probably benign Het
Emid1 G A 11: 5,132,012 T161I probably benign Het
Epn2 A G 11: 61,534,576 probably null Het
Esp36 A T 17: 38,417,164 N75K possibly damaging Het
Faf1 A G 4: 109,935,549 S573G possibly damaging Het
Fam149a T G 8: 45,353,883 S231R probably damaging Het
Fam78a T C 2: 32,069,762 E112G probably damaging Het
Fggy G A 4: 95,697,076 probably null Het
Foxb1 T C 9: 69,759,577 M224V probably benign Het
Gpr75 T C 11: 30,891,808 C238R possibly damaging Het
Gsdmc3 A G 15: 63,858,273 *481R probably null Het
H2afv C A 11: 6,433,750 A57S probably damaging Het
Hsd17b11 T C 5: 103,992,882 I250V probably benign Het
Hus1 C A 11: 8,996,856 L280F probably benign Het
Ide A T 19: 37,329,070 H101Q unknown Het
Ido1 T C 8: 24,584,517 D279G probably benign Het
Inpp5b T C 4: 124,780,421 V307A probably benign Het
Ipo5 G A 14: 120,935,086 V519I probably damaging Het
Krba1 T C 6: 48,406,957 V239A probably benign Het
Lmod3 A G 6: 97,247,164 probably null Het
Macf1 T C 4: 123,499,889 D836G probably damaging Het
Malt1 G T 18: 65,476,280 C774F probably damaging Het
Map2k4 C A 11: 65,709,932 D58Y probably damaging Het
Mc2r T C 18: 68,407,340 N294S probably benign Het
Mybpc1 A G 10: 88,553,254 probably null Het
Mybpc3 A G 2: 91,126,264 E637G possibly damaging Het
Narf A G 11: 121,244,643 Q107R probably damaging Het
Nlrp3 G A 11: 59,549,238 G547D probably benign Het
Nucb2 G T 7: 116,524,305 G51* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Otog C A 7: 46,264,102 D786E probably benign Het
Otogl T C 10: 107,876,855 T543A probably damaging Het
Phf20l1 A G 15: 66,604,855 N266S probably benign Het
Pink1 G T 4: 138,315,555 S446* probably null Het
Pkp4 T G 2: 59,305,450 H186Q probably damaging Het
Prl3b1 T C 13: 27,249,477 V205A probably damaging Het
Prss32 T C 17: 23,859,183 V281A probably damaging Het
Psd3 C T 8: 68,121,169 C120Y probably damaging Het
Ptcra A G 17: 46,758,648 L99P probably damaging Het
Rab3gap2 C T 1: 185,262,829 T855I probably benign Het
Rabgap1l T C 1: 160,238,541 E199G probably damaging Het
Rbm44 T A 1: 91,155,494 C580S probably damaging Het
Rhoq T C 17: 86,995,065 V143A probably benign Het
Sacs T A 14: 61,213,797 Y4431N probably benign Het
Sec24b A T 3: 130,002,379 S367T probably benign Het
Sema4c G A 1: 36,550,185 S620F probably benign Het
Slc12a1 G A 2: 125,228,750 G1054E probably damaging Het
Slc16a3 A G 11: 120,957,968 R417G probably benign Het
Slc22a29 A T 19: 8,218,358 S106T probably benign Het
Slc41a2 T C 10: 83,313,420 T220A probably damaging Het
Tap1 T C 17: 34,193,494 F474L possibly damaging Het
Tas2r106 G T 6: 131,678,459 A143D probably benign Het
Tbx6 A T 7: 126,784,535 probably null Het
Tfap2a T A 13: 40,717,230 N402I probably damaging Het
Tle3 T A 9: 61,373,993 V22E probably damaging Het
Tmem8 T C 17: 26,120,539 F584L probably damaging Het
Trip4 T C 9: 65,858,357 I353M probably damaging Het
Ubr2 C A 17: 46,959,459 probably null Het
Ugdh A G 5: 65,423,448 probably null Het
Uhrf1 T C 17: 56,315,478 V431A probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zfp820 T C 17: 21,819,219 K376R probably benign Het
Other mutations in Fgf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Fgf18 APN 11 33134332 missense probably damaging 1.00
IGL02928:Fgf18 APN 11 33124674 missense possibly damaging 0.62
R2119:Fgf18 UTSW 11 33118003 missense probably damaging 1.00
R2120:Fgf18 UTSW 11 33118003 missense probably damaging 1.00
R2122:Fgf18 UTSW 11 33118003 missense probably damaging 1.00
R2124:Fgf18 UTSW 11 33118003 missense probably damaging 1.00
R5623:Fgf18 UTSW 11 33134272 missense probably damaging 1.00
R7087:Fgf18 UTSW 11 33124677 missense probably damaging 1.00
R7209:Fgf18 UTSW 11 33134315 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCCATCATGTAAGGGGACAC -3'
(R):5'- AGCTTTATGGTTTCCCAGCTG -3'

Sequencing Primer
(F):5'- CCAGTGAGCTTCTTAAGGAGTCAC -3'
(R):5'- ATGGTTTCCCAGCTGCCTCAG -3'
Posted On2016-04-15