Incidental Mutation 'R4913:Drd1'
ID379736
Institutional Source Beutler Lab
Gene Symbol Drd1
Ensembl Gene ENSMUSG00000021478
Gene Namedopamine receptor D1
SynonymsDrd1a, D1 receptor, C030036C15Rik, Gpcr15, Drd-1
MMRRC Submission 042515-MU
Accession Numbers

Genbank: NM_010076.3; Ensembl: ENSMUST00000021932

Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R4913 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location54051183-54055705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54053167 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 343 (T343A)
Ref Sequence ENSEMBL: ENSMUSP00000021932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021932] [ENSMUST00000221470]
Predicted Effect probably benign
Transcript: ENSMUST00000021932
AA Change: T343A

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021932
Gene: ENSMUSG00000021478
AA Change: T343A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 244 7.9e-10 PFAM
Pfam:7TM_GPCR_Srsx 33 345 7e-11 PFAM
Pfam:7tm_1 39 331 6.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221470
AA Change: T336A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222706
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D1 subtype of the dopamine receptor. The D1 subtype is the most abundant dopamine receptor in the central nervous system. This G-protein coupled receptor stimulates adenylyl cyclase and activates cyclic AMP-dependent protein kinases. D1 receptors regulate neuronal growth and development, mediate some behavioral responses, and modulate dopamine receptor D2-mediated events. Alternate transcription initiation sites result in two transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show variably abnormalities that may include growth retardation, death after weaning unless given hydrated food, nonresponsiveness to dopamine D1 receptor agonists and antagonists, and normal to hyperactive locomotor activity. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
9430007A20Rik T A 4: 144,528,811 M267K possibly damaging Het
Acsm5 T C 7: 119,534,343 S244P probably damaging Het
Actr6 A G 10: 89,714,946 F329L probably benign Het
Actrt3 A G 3: 30,598,439 S169P probably benign Het
Agtpbp1 C A 13: 59,500,072 G645C probably damaging Het
AI661453 C T 17: 47,468,555 R1069* probably null Het
Akr1c6 T C 13: 4,454,525 I303T probably benign Het
Arnt A G 3: 95,490,654 R588G probably damaging Het
Atf1 A G 15: 100,252,098 probably null Het
BC052040 A G 2: 115,670,087 probably null Het
Casp12 T C 9: 5,358,726 V318A probably damaging Het
Cblb C T 16: 52,166,029 P545L possibly damaging Het
Cc2d2a A T 5: 43,739,323 I1521F probably benign Het
Ccnb1ip1 T A 14: 50,792,144 K154* probably null Het
Cd300a A T 11: 114,893,372 K69* probably null Het
Clec10a A G 11: 70,170,025 Y78C probably damaging Het
Cnot1 T C 8: 95,763,067 I503V possibly damaging Het
Cpa2 A G 6: 30,554,293 H304R probably damaging Het
Crb2 A T 2: 37,790,245 H395L probably benign Het
Ctgf T C 10: 24,597,327 C255R probably damaging Het
Dnah8 T A 17: 30,819,139 N4257K probably damaging Het
Dnase2a G A 8: 84,908,848 D25N probably damaging Het
Emid1 G A 11: 5,132,012 T161I probably benign Het
Epn2 A G 11: 61,534,576 probably null Het
Esp36 A T 17: 38,417,164 N75K possibly damaging Het
Faf1 A G 4: 109,935,549 S573G possibly damaging Het
Fam149a T G 8: 45,353,883 S231R probably damaging Het
Fam78a T C 2: 32,069,762 E112G probably damaging Het
Fgf18 T C 11: 33,134,316 D46G probably benign Het
Fggy G A 4: 95,697,076 probably null Het
Foxb1 T C 9: 69,759,577 M224V probably benign Het
Gpr75 T C 11: 30,891,808 C238R possibly damaging Het
Gsdmc3 A G 15: 63,858,273 *481R probably null Het
H2afv C A 11: 6,433,750 A57S probably damaging Het
Hsd17b11 T C 5: 103,992,882 I250V probably benign Het
Hus1 C A 11: 8,996,856 L280F probably benign Het
Ide A T 19: 37,329,070 H101Q unknown Het
Ido1 T C 8: 24,584,517 D279G probably benign Het
Inpp5b T C 4: 124,780,421 V307A probably benign Het
Ipo5 G A 14: 120,935,086 V519I probably damaging Het
Krba1 T C 6: 48,406,957 V239A probably benign Het
Lmod3 A G 6: 97,247,164 probably null Het
Macf1 T C 4: 123,499,889 D836G probably damaging Het
Malt1 G T 18: 65,476,280 C774F probably damaging Het
Map2k4 C A 11: 65,709,932 D58Y probably damaging Het
Mc2r T C 18: 68,407,340 N294S probably benign Het
Mybpc1 A G 10: 88,553,254 probably null Het
Mybpc3 A G 2: 91,126,264 E637G possibly damaging Het
Narf A G 11: 121,244,643 Q107R probably damaging Het
Nlrp3 G A 11: 59,549,238 G547D probably benign Het
Nucb2 G T 7: 116,524,305 G51* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Otog C A 7: 46,264,102 D786E probably benign Het
Otogl T C 10: 107,876,855 T543A probably damaging Het
Phf20l1 A G 15: 66,604,855 N266S probably benign Het
Pink1 G T 4: 138,315,555 S446* probably null Het
Pkp4 T G 2: 59,305,450 H186Q probably damaging Het
Prl3b1 T C 13: 27,249,477 V205A probably damaging Het
Prss32 T C 17: 23,859,183 V281A probably damaging Het
Psd3 C T 8: 68,121,169 C120Y probably damaging Het
Ptcra A G 17: 46,758,648 L99P probably damaging Het
Rab3gap2 C T 1: 185,262,829 T855I probably benign Het
Rabgap1l T C 1: 160,238,541 E199G probably damaging Het
Rbm44 T A 1: 91,155,494 C580S probably damaging Het
Rhoq T C 17: 86,995,065 V143A probably benign Het
Sacs T A 14: 61,213,797 Y4431N probably benign Het
Sec24b A T 3: 130,002,379 S367T probably benign Het
Sema4c G A 1: 36,550,185 S620F probably benign Het
Slc12a1 G A 2: 125,228,750 G1054E probably damaging Het
Slc16a3 A G 11: 120,957,968 R417G probably benign Het
Slc22a29 A T 19: 8,218,358 S106T probably benign Het
Slc41a2 T C 10: 83,313,420 T220A probably damaging Het
Tap1 T C 17: 34,193,494 F474L possibly damaging Het
Tas2r106 G T 6: 131,678,459 A143D probably benign Het
Tbx6 A T 7: 126,784,535 probably null Het
Tfap2a T A 13: 40,717,230 N402I probably damaging Het
Tle3 T A 9: 61,373,993 V22E probably damaging Het
Tmem8 T C 17: 26,120,539 F584L probably damaging Het
Trip4 T C 9: 65,858,357 I353M probably damaging Het
Ubr2 C A 17: 46,959,459 probably null Het
Ugdh A G 5: 65,423,448 probably null Het
Uhrf1 T C 17: 56,315,478 V431A probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zfp820 T C 17: 21,819,219 K376R probably benign Het
Other mutations in Drd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Drd1 APN 13 54053878 missense probably damaging 1.00
IGL00231:Drd1 APN 13 54053467 missense probably benign
1mM(1):Drd1 UTSW 13 54053847 missense probably damaging 1.00
H8786:Drd1 UTSW 13 54053103 missense possibly damaging 0.92
R0166:Drd1 UTSW 13 54053581 missense probably damaging 1.00
R0333:Drd1 UTSW 13 54054063 missense probably damaging 1.00
R0661:Drd1 UTSW 13 54053038 missense possibly damaging 0.90
R1022:Drd1 UTSW 13 54053314 missense probably benign 0.00
R1024:Drd1 UTSW 13 54053314 missense probably benign 0.00
R1397:Drd1 UTSW 13 54053554 missense probably damaging 1.00
R1559:Drd1 UTSW 13 54052945 missense probably damaging 0.99
R1907:Drd1 UTSW 13 54053252 missense possibly damaging 0.88
R2128:Drd1 UTSW 13 54053553 missense probably damaging 1.00
R5592:Drd1 UTSW 13 54054171 start codon destroyed probably null 0.90
R5867:Drd1 UTSW 13 54054163 missense probably benign
R6758:Drd1 UTSW 13 54053289 missense probably benign
R6966:Drd1 UTSW 13 54053545 missense probably damaging 1.00
X0028:Drd1 UTSW 13 54053793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTGGCTTAGGTATGCC -3'
(R):5'- GAAACCCTGTCGAATGCTCTC -3'

Sequencing Primer
(F):5'- CCTCTTCAGGTCCTCAGAGG -3'
(R):5'- CTGTCGAATGCTCTCAATCAGAAAG -3'
Posted On2016-04-15