Mutagenetix > Incidental Mutation

Incidental Mutation 'R4913:Dnah8'

379749

Institutional Source

Beutler Lab

Gene Symbol

Dnah8

Ensembl Gene

ENSMUSG00000033826

Gene Name

dynein, axonemal, heavy chain 8

Synonyms

Dnahc8, P1-Loop, Hst6.7b

MMRRC Submission

042515-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.323) question?

Stock #

R4913 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30624354-30875264 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30819139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 4257 (N4257K)

Ref Sequence

ENSEMBL: ENSMUSP00000127878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170651]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000170651
AA Change: N4257K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: N4257K

Domain	Start	End	E-Value	Type
low complexity region	2	54	N/A	INTRINSIC
Pfam:DHC_N1	379	936	8.4e-159	PFAM
low complexity region	1069	1080	N/A	INTRINSIC
low complexity region	1224	1237	N/A	INTRINSIC
Pfam:DHC_N2	1509	1917	1.6e-134	PFAM
AAA	2082	2226	1.38e-1	SMART
AAA	2363	2516	2.04e-1	SMART
AAA	2689	2837	8.15e-2	SMART
Pfam:AAA_8	3022	3294	4e-72	PFAM
Pfam:MT	3306	3656	3.6e-48	PFAM
Pfam:AAA_9	3676	3901	6.7e-85	PFAM
Pfam:Dynein_heavy	4039	4728	8.4e-250	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	G	6: 149,329,389	S1311C	probably damaging	Het
9430007A20Rik	T	A	4: 144,528,811	M267K	possibly damaging	Het
Acsm5	T	C	7: 119,534,343	S244P	probably damaging	Het
Actr6	A	G	10: 89,714,946	F329L	probably benign	Het
Actrt3	A	G	3: 30,598,439	S169P	probably benign	Het
Agtpbp1	C	A	13: 59,500,072	G645C	probably damaging	Het
AI661453	C	T	17: 47,468,555	R1069*	probably null	Het
Akr1c6	T	C	13: 4,454,525	I303T	probably benign	Het
Arnt	A	G	3: 95,490,654	R588G	probably damaging	Het
Atf1	A	G	15: 100,252,098		probably null	Het
BC052040	A	G	2: 115,670,087		probably null	Het
Casp12	T	C	9: 5,358,726	V318A	probably damaging	Het
Cblb	C	T	16: 52,166,029	P545L	possibly damaging	Het
Cc2d2a	A	T	5: 43,739,323	I1521F	probably benign	Het
Ccnb1ip1	T	A	14: 50,792,144	K154*	probably null	Het
Cd300a	A	T	11: 114,893,372	K69*	probably null	Het
Clec10a	A	G	11: 70,170,025	Y78C	probably damaging	Het
Cnot1	T	C	8: 95,763,067	I503V	possibly damaging	Het
Cpa2	A	G	6: 30,554,293	H304R	probably damaging	Het
Crb2	A	T	2: 37,790,245	H395L	probably benign	Het
Ctgf	T	C	10: 24,597,327	C255R	probably damaging	Het
Dnase2a	G	A	8: 84,908,848	D25N	probably damaging	Het
Drd1	T	C	13: 54,053,167	T343A	probably benign	Het
Emid1	G	A	11: 5,132,012	T161I	probably benign	Het
Epn2	A	G	11: 61,534,576		probably null	Het
Esp36	A	T	17: 38,417,164	N75K	possibly damaging	Het
Faf1	A	G	4: 109,935,549	S573G	possibly damaging	Het
Fam149a	T	G	8: 45,353,883	S231R	probably damaging	Het
Fam78a	T	C	2: 32,069,762	E112G	probably damaging	Het
Fgf18	T	C	11: 33,134,316	D46G	probably benign	Het
Fggy	G	A	4: 95,697,076		probably null	Het
Foxb1	T	C	9: 69,759,577	M224V	probably benign	Het
Gpr75	T	C	11: 30,891,808	C238R	possibly damaging	Het
Gsdmc3	A	G	15: 63,858,273	*481R	probably null	Het
H2afv	C	A	11: 6,433,750	A57S	probably damaging	Het
Hsd17b11	T	C	5: 103,992,882	I250V	probably benign	Het
Hus1	C	A	11: 8,996,856	L280F	probably benign	Het
Ide	A	T	19: 37,329,070	H101Q	unknown	Het
Ido1	T	C	8: 24,584,517	D279G	probably benign	Het
Inpp5b	T	C	4: 124,780,421	V307A	probably benign	Het
Ipo5	G	A	14: 120,935,086	V519I	probably damaging	Het
Krba1	T	C	6: 48,406,957	V239A	probably benign	Het
Lmod3	A	G	6: 97,247,164		probably null	Het
Macf1	T	C	4: 123,499,889	D836G	probably damaging	Het
Malt1	G	T	18: 65,476,280	C774F	probably damaging	Het
Map2k4	C	A	11: 65,709,932	D58Y	probably damaging	Het
Mc2r	T	C	18: 68,407,340	N294S	probably benign	Het
Mybpc1	A	G	10: 88,553,254		probably null	Het
Mybpc3	A	G	2: 91,126,264	E637G	possibly damaging	Het
Narf	A	G	11: 121,244,643	Q107R	probably damaging	Het
Nlrp3	G	A	11: 59,549,238	G547D	probably benign	Het
Nucb2	G	T	7: 116,524,305	G51*	probably null	Het
Olfr121	T	A	17: 37,752,424	V190D	possibly damaging	Het
Otog	C	A	7: 46,264,102	D786E	probably benign	Het
Otogl	T	C	10: 107,876,855	T543A	probably damaging	Het
Phf20l1	A	G	15: 66,604,855	N266S	probably benign	Het
Pink1	G	T	4: 138,315,555	S446*	probably null	Het
Pkp4	T	G	2: 59,305,450	H186Q	probably damaging	Het
Prl3b1	T	C	13: 27,249,477	V205A	probably damaging	Het
Prss32	T	C	17: 23,859,183	V281A	probably damaging	Het
Psd3	C	T	8: 68,121,169	C120Y	probably damaging	Het
Ptcra	A	G	17: 46,758,648	L99P	probably damaging	Het
Rab3gap2	C	T	1: 185,262,829	T855I	probably benign	Het
Rabgap1l	T	C	1: 160,238,541	E199G	probably damaging	Het
Rbm44	T	A	1: 91,155,494	C580S	probably damaging	Het
Rhoq	T	C	17: 86,995,065	V143A	probably benign	Het
Sacs	T	A	14: 61,213,797	Y4431N	probably benign	Het
Sec24b	A	T	3: 130,002,379	S367T	probably benign	Het
Sema4c	G	A	1: 36,550,185	S620F	probably benign	Het
Slc12a1	G	A	2: 125,228,750	G1054E	probably damaging	Het
Slc16a3	A	G	11: 120,957,968	R417G	probably benign	Het
Slc22a29	A	T	19: 8,218,358	S106T	probably benign	Het
Slc41a2	T	C	10: 83,313,420	T220A	probably damaging	Het
Tap1	T	C	17: 34,193,494	F474L	possibly damaging	Het
Tas2r106	G	T	6: 131,678,459	A143D	probably benign	Het
Tbx6	A	T	7: 126,784,535		probably null	Het
Tfap2a	T	A	13: 40,717,230	N402I	probably damaging	Het
Tle3	T	A	9: 61,373,993	V22E	probably damaging	Het
Tmem8	T	C	17: 26,120,539	F584L	probably damaging	Het
Trip4	T	C	9: 65,858,357	I353M	probably damaging	Het
Ubr2	C	A	17: 46,959,459		probably null	Het
Ugdh	A	G	5: 65,423,448		probably null	Het
Uhrf1	T	C	17: 56,315,478	V431A	probably damaging	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Zfp820	T	C	17: 21,819,219	K376R	probably benign	Het

Other mutations in Dnah8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Dnah8	APN	17	30677176	missense	probably benign	0.06
IGL00508:Dnah8	APN	17	30855930	missense	probably damaging	1.00
IGL00547:Dnah8	APN	17	30815703	nonsense	probably null
IGL00551:Dnah8	APN	17	30663478	nonsense	probably null
IGL00732:Dnah8	APN	17	30656641	missense	probably damaging	1.00
IGL00775:Dnah8	APN	17	30767906	nonsense	probably null
IGL00840:Dnah8	APN	17	30790941	missense	probably damaging	1.00
IGL00845:Dnah8	APN	17	30819276	critical splice donor site	probably null
IGL00953:Dnah8	APN	17	30706457	nonsense	probably null
IGL00976:Dnah8	APN	17	30851710	missense	probably damaging	0.98
IGL01395:Dnah8	APN	17	30636005	missense	probably benign	0.06
IGL01467:Dnah8	APN	17	30779916	missense	probably damaging	1.00
IGL01469:Dnah8	APN	17	30683714	splice site	probably benign
IGL01515:Dnah8	APN	17	30648485	missense	probably benign
IGL01723:Dnah8	APN	17	30708471	missense	probably damaging	1.00
IGL01837:Dnah8	APN	17	30751591	critical splice donor site	probably null
IGL01921:Dnah8	APN	17	30736141	missense	probably benign
IGL01958:Dnah8	APN	17	30855895	splice site	probably benign
IGL01968:Dnah8	APN	17	30656598	nonsense	probably null
IGL02093:Dnah8	APN	17	30717880	missense	probably damaging	0.99
IGL02151:Dnah8	APN	17	30648417	missense	possibly damaging	0.50
IGL02182:Dnah8	APN	17	30794763	missense	possibly damaging	0.45
IGL02233:Dnah8	APN	17	30706513	critical splice donor site	probably null
IGL02236:Dnah8	APN	17	30649773	nonsense	probably null
IGL02259:Dnah8	APN	17	30759614	missense	probably benign
IGL02263:Dnah8	APN	17	30729165	missense	probably benign	0.00
IGL02303:Dnah8	APN	17	30713047	missense	probably benign	0.03
IGL02341:Dnah8	APN	17	30747257	missense	probably damaging	1.00
IGL02351:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02358:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02377:Dnah8	APN	17	30794796	missense	probably damaging	0.98
IGL02390:Dnah8	APN	17	30830845	missense	probably benign	0.01
IGL02392:Dnah8	APN	17	30818051	splice site	probably benign
IGL02414:Dnah8	APN	17	30700413	missense	probably benign
IGL02455:Dnah8	APN	17	30672334	missense	probably damaging	0.99
IGL02817:Dnah8	APN	17	30668295	missense	probably benign
IGL02831:Dnah8	APN	17	30712276	missense	probably benign	0.23
IGL02863:Dnah8	APN	17	30769697	missense	probably damaging	1.00
IGL02894:Dnah8	APN	17	30721110	nonsense	probably null
IGL02954:Dnah8	APN	17	30704835	missense	probably benign	0.30
IGL02964:Dnah8	APN	17	30746761	missense	probably damaging	1.00
IGL03080:Dnah8	APN	17	30719006	missense	probably benign	0.01
IGL03081:Dnah8	APN	17	30686373	splice site	probably benign
IGL03086:Dnah8	APN	17	30742780	missense	probably damaging	1.00
IGL03087:Dnah8	APN	17	30784144	missense	probably benign
IGL03176:Dnah8	APN	17	30694037	missense	probably benign
IGL03191:Dnah8	APN	17	30726830	missense	probably damaging	0.99
IGL03210:Dnah8	APN	17	30815665	missense	probably damaging	0.96
IGL03252:Dnah8	APN	17	30673920	splice site	probably null
IGL03255:Dnah8	APN	17	30741381	missense	probably damaging	1.00
IGL03288:Dnah8	APN	17	30672349	missense	probably benign
IGL03348:Dnah8	APN	17	30746986	missense	probably damaging	0.99
Alternator	UTSW	17	30765635	missense	probably benign
armature	UTSW	17	30708390	missense	probably benign	0.02
Brush	UTSW	17	30746990	missense	probably damaging	1.00
Dynos	UTSW	17	30715509	missense	possibly damaging	0.84
joule	UTSW	17	30713098	critical splice donor site	probably null
solenoid	UTSW	17	30741178	missense	probably damaging	1.00
FR4340:Dnah8	UTSW	17	30635463	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635465	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635477	small deletion	probably benign
I2288:Dnah8	UTSW	17	30663454	missense	probably benign
P0029:Dnah8	UTSW	17	30765720	missense	probably damaging	1.00
PIT4812001:Dnah8	UTSW	17	30708445	missense	probably benign	0.04
R0016:Dnah8	UTSW	17	30663316	missense	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0087:Dnah8	UTSW	17	30755119	missense	probably damaging	1.00
R0090:Dnah8	UTSW	17	30784090	missense	probably benign	0.20
R0119:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0184:Dnah8	UTSW	17	30683683	missense	probably benign	0.04
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0265:Dnah8	UTSW	17	30690271	missense	probably benign
R0268:Dnah8	UTSW	17	30769707	missense	probably damaging	1.00
R0282:Dnah8	UTSW	17	30736156	missense	probably damaging	1.00
R0299:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0334:Dnah8	UTSW	17	30871351	missense	probably damaging	0.99
R0393:Dnah8	UTSW	17	30708390	missense	probably benign	0.02
R0423:Dnah8	UTSW	17	30701981	missense	probably benign
R0470:Dnah8	UTSW	17	30708540	splice site	probably benign
R0477:Dnah8	UTSW	17	30755080	missense	probably damaging	1.00
R0490:Dnah8	UTSW	17	30700419	missense	probably benign
R0499:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0582:Dnah8	UTSW	17	30718961	missense	probably benign	0.01
R0601:Dnah8	UTSW	17	30708358	missense	probably benign	0.06
R0646:Dnah8	UTSW	17	30684173	missense	probably damaging	0.97
R0665:Dnah8	UTSW	17	30736155	missense	probably damaging	0.99
R0800:Dnah8	UTSW	17	30704662	missense	probably benign
R0843:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R0940:Dnah8	UTSW	17	30803243	missense	probably damaging	1.00
R0964:Dnah8	UTSW	17	30673920	splice site	probably null
R1102:Dnah8	UTSW	17	30854764	splice site	probably null
R1137:Dnah8	UTSW	17	30855936	missense	probably damaging	1.00
R1342:Dnah8	UTSW	17	30721000	missense	probably damaging	0.99
R1375:Dnah8	UTSW	17	30737295	missense	probably damaging	1.00
R1377:Dnah8	UTSW	17	30840622	nonsense	probably null
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1497:Dnah8	UTSW	17	30752075	missense	probably damaging	1.00
R1513:Dnah8	UTSW	17	30673888	missense	probably benign
R1541:Dnah8	UTSW	17	30747247	missense	probably damaging	1.00
R1563:Dnah8	UTSW	17	30635664	missense	probably benign	0.07
R1634:Dnah8	UTSW	17	30713098	critical splice donor site	probably null
R1670:Dnah8	UTSW	17	30725124	missense	probably damaging	1.00
R1710:Dnah8	UTSW	17	30854940	missense	probably damaging	1.00
R1743:Dnah8	UTSW	17	30769651	missense	probably benign	0.28
R1761:Dnah8	UTSW	17	30779916	missense	probably damaging	1.00
R1785:Dnah8	UTSW	17	30722937	missense	probably damaging	0.98
R1804:Dnah8	UTSW	17	30708407	missense	probably benign	0.00
R1808:Dnah8	UTSW	17	30684186	missense	probably damaging	1.00
R1824:Dnah8	UTSW	17	30731180	missense	possibly damaging	0.67
R1836:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R1935:Dnah8	UTSW	17	30635505	missense	unknown
R1935:Dnah8	UTSW	17	30726896	splice site	probably benign
R1940:Dnah8	UTSW	17	30731207	missense	probably damaging	1.00
R1946:Dnah8	UTSW	17	30712385	missense	probably benign	0.00
R2025:Dnah8	UTSW	17	30731159	missense	probably damaging	0.99
R2038:Dnah8	UTSW	17	30758281	missense	probably damaging	1.00
R2042:Dnah8	UTSW	17	30635658	missense	probably benign	0.01
R2148:Dnah8	UTSW	17	30737258	missense	probably damaging	1.00
R2177:Dnah8	UTSW	17	30653393	missense	probably benign
R2180:Dnah8	UTSW	17	30840647	missense	probably benign	0.00
R2262:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2263:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2328:Dnah8	UTSW	17	30794744	missense	probably damaging	1.00
R2357:Dnah8	UTSW	17	30771872	missense	probably benign
R2357:Dnah8	UTSW	17	30874935	missense	probably benign	0.00
R2360:Dnah8	UTSW	17	30677204	missense	probably benign	0.22
R2496:Dnah8	UTSW	17	30851731	missense	probably damaging	1.00
R2497:Dnah8	UTSW	17	30741365	nonsense	probably null
R2509:Dnah8	UTSW	17	30775045	missense	probably benign	0.02
R3114:Dnah8	UTSW	17	30833568	missense	probably benign	0.04
R3708:Dnah8	UTSW	17	30739657	missense	probably damaging	0.98
R3720:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3722:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3727:Dnah8	UTSW	17	30739648	nonsense	probably null
R3747:Dnah8	UTSW	17	30784174	nonsense	probably null
R3748:Dnah8	UTSW	17	30784174	nonsense	probably null
R3749:Dnah8	UTSW	17	30784174	nonsense	probably null
R3787:Dnah8	UTSW	17	30755041	missense	probably damaging	1.00
R3790:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3804:Dnah8	UTSW	17	30670647	missense	probably benign	0.00
R3857:Dnah8	UTSW	17	30663422	missense	probably damaging	0.96
R3898:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3899:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3938:Dnah8	UTSW	17	30854937	missense	probably damaging	1.00
R3943:Dnah8	UTSW	17	30694065	splice site	probably benign
R4091:Dnah8	UTSW	17	30769839	missense	probably damaging	1.00
R4291:Dnah8	UTSW	17	30748559	missense	probably benign
R4326:Dnah8	UTSW	17	30752092	missense	probably benign	0.04
R4346:Dnah8	UTSW	17	30725098	missense	possibly damaging	0.92
R4429:Dnah8	UTSW	17	30752146	missense	probably damaging	1.00
R4457:Dnah8	UTSW	17	30813151	missense	probably benign
R4475:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4565:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4566:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4568:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4573:Dnah8	UTSW	17	30700406	missense	probably benign	0.00
R4580:Dnah8	UTSW	17	30662052	missense	probably benign	0.00
R4585:Dnah8	UTSW	17	30751567	missense	probably benign	0.01
R4611:Dnah8	UTSW	17	30684237	missense	probably damaging	1.00
R4720:Dnah8	UTSW	17	30683634	missense	probably benign	0.08
R4721:Dnah8	UTSW	17	30725166	missense	probably damaging	1.00
R4727:Dnah8	UTSW	17	30851747	missense	probably damaging	1.00
R4731:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4732:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4733:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4798:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4814:Dnah8	UTSW	17	30767924	missense	probably damaging	1.00
R4892:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4894:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4900:Dnah8	UTSW	17	30746975	missense	probably damaging	1.00
R4901:Dnah8	UTSW	17	30840714	critical splice donor site	probably null
R4931:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4932:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4933:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4942:Dnah8	UTSW	17	30729142	missense	probably benign
R4969:Dnah8	UTSW	17	30723014	missense	probably damaging	1.00
R4975:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4977:Dnah8	UTSW	17	30663301	missense	probably benign	0.00
R5001:Dnah8	UTSW	17	30787185	missense	probably damaging	1.00
R5011:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5013:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5014:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5024:Dnah8	UTSW	17	30736096	missense	probably damaging	1.00
R5075:Dnah8	UTSW	17	30739757	critical splice donor site	probably null
R5075:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5075:Dnah8	UTSW	17	30800531	missense	probably damaging	1.00
R5112:Dnah8	UTSW	17	30731038	missense	probably benign	0.02
R5121:Dnah8	UTSW	17	30810353	missense	probably benign	0.14
R5138:Dnah8	UTSW	17	30765597	missense	probably damaging	0.99
R5151:Dnah8	UTSW	17	30712295	missense	probably benign	0.06
R5191:Dnah8	UTSW	17	30746765	missense	probably damaging	1.00
R5238:Dnah8	UTSW	17	30790917	missense	probably damaging	1.00
R5260:Dnah8	UTSW	17	30700419	missense	probably benign
R5358:Dnah8	UTSW	17	30746954	missense	probably damaging	1.00
R5403:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5404:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5482:Dnah8	UTSW	17	30800547	missense	probably damaging	0.96
R5489:Dnah8	UTSW	17	30790956	missense	probably damaging	1.00
R5513:Dnah8	UTSW	17	30752916	missense	probably damaging	0.99
R5635:Dnah8	UTSW	17	30706386	missense	probably benign	0.00
R5640:Dnah8	UTSW	17	30803108	missense	probably damaging	1.00
R5649:Dnah8	UTSW	17	30800587	missense	probably benign	0.13
R5662:Dnah8	UTSW	17	30737333	missense	probably damaging	1.00
R5673:Dnah8	UTSW	17	30803261	missense	probably damaging	1.00
R5677:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5699:Dnah8	UTSW	17	30810324	missense	probably benign	0.22
R5737:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5738:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5739:Dnah8	UTSW	17	30719007	missense	probably benign	0.00
R5766:Dnah8	UTSW	17	30690261	missense	probably benign	0.01
R5790:Dnah8	UTSW	17	30875004	missense	probably damaging	0.98
R5848:Dnah8	UTSW	17	30728191	missense	possibly damaging	0.69
R5854:Dnah8	UTSW	17	30794763	missense	possibly damaging	0.45
R5885:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5886:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5887:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5899:Dnah8	UTSW	17	30656685	missense	probably benign	0.32
R5979:Dnah8	UTSW	17	30815664	nonsense	probably null
R5986:Dnah8	UTSW	17	30851630	missense	possibly damaging	0.83
R5999:Dnah8	UTSW	17	30663305	missense	probably benign	0.32
R6042:Dnah8	UTSW	17	30747265	missense	probably damaging	1.00
R6175:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6181:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6237:Dnah8	UTSW	17	30747854	nonsense	probably null
R6239:Dnah8	UTSW	17	30810359	missense	probably damaging	0.99
R6337:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6365:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6416:Dnah8	UTSW	17	30765635	missense	probably benign
R6443:Dnah8	UTSW	17	30771885	missense	probably benign	0.10
R6478:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6479:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6480:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6481:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6533:Dnah8	UTSW	17	30746990	missense	probably damaging	1.00
R6606:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6608:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6610:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6675:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6723:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6724:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6754:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6755:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6759:Dnah8	UTSW	17	30663292	splice site	probably null
R6765:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6766:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6778:Dnah8	UTSW	17	30635666	missense	probably benign	0.00
R6781:Dnah8	UTSW	17	30765724	frame shift	probably null
R6788:Dnah8	UTSW	17	30648465	missense	probably benign	0.14
R6814:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6825:Dnah8	UTSW	17	30741173	missense	probably damaging	1.00
R6838:Dnah8	UTSW	17	30710551	missense	probably damaging	1.00
R6872:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6877:Dnah8	UTSW	17	30746959	missense	probably damaging	1.00
R6944:Dnah8	UTSW	17	30794659	missense	probably benign	0.09
R6982:Dnah8	UTSW	17	30767925	missense	probably benign	0.03
R6984:Dnah8	UTSW	17	30739738	missense	probably damaging	1.00
R6987:Dnah8	UTSW	17	30662091	missense	possibly damaging	0.95
R6988:Dnah8	UTSW	17	30643275	missense	probably damaging	1.00
R7099:Dnah8	UTSW	17	30704724	missense	possibly damaging	0.93
R7106:Dnah8	UTSW	17	30741178	missense	probably damaging	1.00
R7112:Dnah8	UTSW	17	30871392	missense	possibly damaging	0.79
R7146:Dnah8	UTSW	17	30644617	missense	probably benign	0.01
R7146:Dnah8	UTSW	17	30769644	missense	possibly damaging	0.90
R7309:Dnah8	UTSW	17	30875014	missense	probably damaging	1.00
R7324:Dnah8	UTSW	17	30784125	missense	probably benign	0.01
R7373:Dnah8	UTSW	17	30767965	critical splice donor site	probably null
R7423:Dnah8	UTSW	17	30704769	missense	possibly damaging	0.86
R7430:Dnah8	UTSW	17	30706389	missense	probably damaging	0.98
R7450:Dnah8	UTSW	17	30787191	missense	probably damaging	0.99
R7580:Dnah8	UTSW	17	30775103	missense	probably damaging	0.98
R7604:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R7635:Dnah8	UTSW	17	30785107	missense	probably damaging	1.00
R7646:Dnah8	UTSW	17	30649677	missense	probably benign	0.00
R7685:Dnah8	UTSW	17	30657973	missense	probably damaging	1.00
R7793:Dnah8	UTSW	17	30855944	missense	probably benign	0.20
R7827:Dnah8	UTSW	17	30760867	frame shift	probably null
R7866:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R7877:Dnah8	UTSW	17	30663374	missense	probably benign
R7891:Dnah8	UTSW	17	30712289	missense	probably benign	0.09
R7977:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R7987:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R8025:Dnah8	UTSW	17	30741337	nonsense	probably null
R8076:Dnah8	UTSW	17	30784153	missense	possibly damaging	0.94
R8170:Dnah8	UTSW	17	30673823	missense	probably damaging	1.00
R8199:Dnah8	UTSW	17	30871419	missense	probably benign	0.06
R8253:Dnah8	UTSW	17	30760867	frame shift	probably null
R8270:Dnah8	UTSW	17	30840713	missense	probably damaging	1.00
R8291:Dnah8	UTSW	17	30765727	missense	probably damaging	1.00
R8334:Dnah8	UTSW	17	30769831	missense	probably benign	0.12
R8348:Dnah8	UTSW	17	30673840	missense	probably benign
R8348:Dnah8	UTSW	17	30736147	missense	probably damaging	0.96
R8354:Dnah8	UTSW	17	30643260	missense	probably benign	0.17
R8355:Dnah8	UTSW	17	30695178	missense	possibly damaging	0.89
R8439:Dnah8	UTSW	17	30760867	frame shift	probably null
R8448:Dnah8	UTSW	17	30673840	missense	probably benign
R8459:Dnah8	UTSW	17	30725247	critical splice donor site	probably null
R8462:Dnah8	UTSW	17	30656629	missense	probably damaging	1.00
R8506:Dnah8	UTSW	17	30721134	missense	probably benign
R8524:Dnah8	UTSW	17	30715498	missense	possibly damaging	0.95
R8555:Dnah8	UTSW	17	30721110	nonsense	probably null
R8698:Dnah8	UTSW	17	30875035	missense	probably damaging	1.00
R8719:Dnah8	UTSW	17	30741315	missense	probably damaging	0.97
R8778:Dnah8	UTSW	17	30760867	frame shift	probably null
R8781:Dnah8	UTSW	17	30725104	missense	probably damaging	1.00
R8821:Dnah8	UTSW	17	30794738	missense	probably damaging	1.00
R8864:Dnah8	UTSW	17	30762642	missense	possibly damaging	0.95
R8885:Dnah8	UTSW	17	30708312	missense	possibly damaging	0.83
R8983:Dnah8	UTSW	17	30851654	missense	probably damaging	0.98
R8994:Dnah8	UTSW	17	30790833	missense	probably benign	0.05
R9031:Dnah8	UTSW	17	30737427	missense	probably damaging	1.00
R9068:Dnah8	UTSW	17	30756755	missense	possibly damaging	0.63
R9225:Dnah8	UTSW	17	30635673	missense	probably benign	0.01
R9280:Dnah8	UTSW	17	30785097	missense	possibly damaging	0.52
R9291:Dnah8	UTSW	17	30725125	missense	probably damaging	1.00
R9314:Dnah8	UTSW	17	30771883	missense	probably benign
R9347:Dnah8	UTSW	17	30708359	missense	probably benign	0.00
R9393:Dnah8	UTSW	17	30653387	missense	possibly damaging	0.53
R9415:Dnah8	UTSW	17	30810323	missense	probably benign	0.02
R9458:Dnah8	UTSW	17	30830803	missense	probably damaging	1.00
R9465:Dnah8	UTSW	17	30760867	frame shift	probably null
R9518:Dnah8	UTSW	17	30760867	frame shift	probably null
R9524:Dnah8	UTSW	17	30760867	frame shift	probably null
R9564:Dnah8	UTSW	17	30713047	missense	probably benign	0.07
R9587:Dnah8	UTSW	17	30760867	frame shift	probably null
R9599:Dnah8	UTSW	17	30760867	frame shift	probably null
R9641:Dnah8	UTSW	17	30713055	missense	probably benign	0.13
R9674:Dnah8	UTSW	17	30779138	missense	possibly damaging	0.84
R9679:Dnah8	UTSW	17	30818141	missense	probably benign
R9789:Dnah8	UTSW	17	30761130	critical splice donor site	probably null
RF027:Dnah8	UTSW	17	30635476	frame shift	probably null
X0001:Dnah8	UTSW	17	30748680	missense	probably damaging	1.00
X0013:Dnah8	UTSW	17	30819186	missense	possibly damaging	0.71
Z1176:Dnah8	UTSW	17	30648540	missense	probably benign
Z1177:Dnah8	UTSW	17	30694033	missense	probably benign
Z1177:Dnah8	UTSW	17	30713095	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCGTATCCAATATGCCATGGTTTC -3'
(R):5'- TCATTAGCGCCTCCTAGCAG -3'

Sequencing Primer
(F):5'- CCCTTAGGATTGCAGTTACAGACAG -3'
(R):5'- TTAGCGCCTCCTAGCAGTGAAC -3'

Posted On

2016-04-15