Incidental Mutation 'R4913:Dnah8'
ID 379749
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms Dnahc8, P1-Loop, Hst6.7b
MMRRC Submission 042515-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R4913 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 30624354-30875264 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30819139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 4257 (N4257K)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000170651
AA Change: N4257K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: N4257K

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
9430007A20Rik T A 4: 144,528,811 M267K possibly damaging Het
Acsm5 T C 7: 119,534,343 S244P probably damaging Het
Actr6 A G 10: 89,714,946 F329L probably benign Het
Actrt3 A G 3: 30,598,439 S169P probably benign Het
Agtpbp1 C A 13: 59,500,072 G645C probably damaging Het
AI661453 C T 17: 47,468,555 R1069* probably null Het
Akr1c6 T C 13: 4,454,525 I303T probably benign Het
Arnt A G 3: 95,490,654 R588G probably damaging Het
Atf1 A G 15: 100,252,098 probably null Het
BC052040 A G 2: 115,670,087 probably null Het
Casp12 T C 9: 5,358,726 V318A probably damaging Het
Cblb C T 16: 52,166,029 P545L possibly damaging Het
Cc2d2a A T 5: 43,739,323 I1521F probably benign Het
Ccnb1ip1 T A 14: 50,792,144 K154* probably null Het
Cd300a A T 11: 114,893,372 K69* probably null Het
Clec10a A G 11: 70,170,025 Y78C probably damaging Het
Cnot1 T C 8: 95,763,067 I503V possibly damaging Het
Cpa2 A G 6: 30,554,293 H304R probably damaging Het
Crb2 A T 2: 37,790,245 H395L probably benign Het
Ctgf T C 10: 24,597,327 C255R probably damaging Het
Dnase2a G A 8: 84,908,848 D25N probably damaging Het
Drd1 T C 13: 54,053,167 T343A probably benign Het
Emid1 G A 11: 5,132,012 T161I probably benign Het
Epn2 A G 11: 61,534,576 probably null Het
Esp36 A T 17: 38,417,164 N75K possibly damaging Het
Faf1 A G 4: 109,935,549 S573G possibly damaging Het
Fam149a T G 8: 45,353,883 S231R probably damaging Het
Fam78a T C 2: 32,069,762 E112G probably damaging Het
Fgf18 T C 11: 33,134,316 D46G probably benign Het
Fggy G A 4: 95,697,076 probably null Het
Foxb1 T C 9: 69,759,577 M224V probably benign Het
Gpr75 T C 11: 30,891,808 C238R possibly damaging Het
Gsdmc3 A G 15: 63,858,273 *481R probably null Het
H2afv C A 11: 6,433,750 A57S probably damaging Het
Hsd17b11 T C 5: 103,992,882 I250V probably benign Het
Hus1 C A 11: 8,996,856 L280F probably benign Het
Ide A T 19: 37,329,070 H101Q unknown Het
Ido1 T C 8: 24,584,517 D279G probably benign Het
Inpp5b T C 4: 124,780,421 V307A probably benign Het
Ipo5 G A 14: 120,935,086 V519I probably damaging Het
Krba1 T C 6: 48,406,957 V239A probably benign Het
Lmod3 A G 6: 97,247,164 probably null Het
Macf1 T C 4: 123,499,889 D836G probably damaging Het
Malt1 G T 18: 65,476,280 C774F probably damaging Het
Map2k4 C A 11: 65,709,932 D58Y probably damaging Het
Mc2r T C 18: 68,407,340 N294S probably benign Het
Mybpc1 A G 10: 88,553,254 probably null Het
Mybpc3 A G 2: 91,126,264 E637G possibly damaging Het
Narf A G 11: 121,244,643 Q107R probably damaging Het
Nlrp3 G A 11: 59,549,238 G547D probably benign Het
Nucb2 G T 7: 116,524,305 G51* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Otog C A 7: 46,264,102 D786E probably benign Het
Otogl T C 10: 107,876,855 T543A probably damaging Het
Phf20l1 A G 15: 66,604,855 N266S probably benign Het
Pink1 G T 4: 138,315,555 S446* probably null Het
Pkp4 T G 2: 59,305,450 H186Q probably damaging Het
Prl3b1 T C 13: 27,249,477 V205A probably damaging Het
Prss32 T C 17: 23,859,183 V281A probably damaging Het
Psd3 C T 8: 68,121,169 C120Y probably damaging Het
Ptcra A G 17: 46,758,648 L99P probably damaging Het
Rab3gap2 C T 1: 185,262,829 T855I probably benign Het
Rabgap1l T C 1: 160,238,541 E199G probably damaging Het
Rbm44 T A 1: 91,155,494 C580S probably damaging Het
Rhoq T C 17: 86,995,065 V143A probably benign Het
Sacs T A 14: 61,213,797 Y4431N probably benign Het
Sec24b A T 3: 130,002,379 S367T probably benign Het
Sema4c G A 1: 36,550,185 S620F probably benign Het
Slc12a1 G A 2: 125,228,750 G1054E probably damaging Het
Slc16a3 A G 11: 120,957,968 R417G probably benign Het
Slc22a29 A T 19: 8,218,358 S106T probably benign Het
Slc41a2 T C 10: 83,313,420 T220A probably damaging Het
Tap1 T C 17: 34,193,494 F474L possibly damaging Het
Tas2r106 G T 6: 131,678,459 A143D probably benign Het
Tbx6 A T 7: 126,784,535 probably null Het
Tfap2a T A 13: 40,717,230 N402I probably damaging Het
Tle3 T A 9: 61,373,993 V22E probably damaging Het
Tmem8 T C 17: 26,120,539 F584L probably damaging Het
Trip4 T C 9: 65,858,357 I353M probably damaging Het
Ubr2 C A 17: 46,959,459 probably null Het
Ugdh A G 5: 65,423,448 probably null Het
Uhrf1 T C 17: 56,315,478 V431A probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zfp820 T C 17: 21,819,219 K376R probably benign Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30677176 missense probably benign 0.06
IGL00508:Dnah8 APN 17 30855930 missense probably damaging 1.00
IGL00547:Dnah8 APN 17 30815703 nonsense probably null
IGL00551:Dnah8 APN 17 30663478 nonsense probably null
IGL00732:Dnah8 APN 17 30656641 missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30767906 nonsense probably null
IGL00840:Dnah8 APN 17 30790941 missense probably damaging 1.00
IGL00845:Dnah8 APN 17 30819276 critical splice donor site probably null
IGL00953:Dnah8 APN 17 30706457 nonsense probably null
IGL00976:Dnah8 APN 17 30851710 missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30636005 missense probably benign 0.06
IGL01467:Dnah8 APN 17 30779916 missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30683714 splice site probably benign
IGL01515:Dnah8 APN 17 30648485 missense probably benign
IGL01723:Dnah8 APN 17 30708471 missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30751591 critical splice donor site probably null
IGL01921:Dnah8 APN 17 30736141 missense probably benign
IGL01958:Dnah8 APN 17 30855895 splice site probably benign
IGL01968:Dnah8 APN 17 30656598 nonsense probably null
IGL02093:Dnah8 APN 17 30717880 missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30648417 missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 30794763 missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30706513 critical splice donor site probably null
IGL02236:Dnah8 APN 17 30649773 nonsense probably null
IGL02259:Dnah8 APN 17 30759614 missense probably benign
IGL02263:Dnah8 APN 17 30729165 missense probably benign 0.00
IGL02303:Dnah8 APN 17 30713047 missense probably benign 0.03
IGL02341:Dnah8 APN 17 30747257 missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02377:Dnah8 APN 17 30794796 missense probably damaging 0.98
IGL02390:Dnah8 APN 17 30830845 missense probably benign 0.01
IGL02392:Dnah8 APN 17 30818051 splice site probably benign
IGL02414:Dnah8 APN 17 30700413 missense probably benign
IGL02455:Dnah8 APN 17 30672334 missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30668295 missense probably benign
IGL02831:Dnah8 APN 17 30712276 missense probably benign 0.23
IGL02863:Dnah8 APN 17 30769697 missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30721110 nonsense probably null
IGL02954:Dnah8 APN 17 30704835 missense probably benign 0.30
IGL02964:Dnah8 APN 17 30746761 missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30719006 missense probably benign 0.01
IGL03081:Dnah8 APN 17 30686373 splice site probably benign
IGL03086:Dnah8 APN 17 30742780 missense probably damaging 1.00
IGL03087:Dnah8 APN 17 30784144 missense probably benign
IGL03176:Dnah8 APN 17 30694037 missense probably benign
IGL03191:Dnah8 APN 17 30726830 missense probably damaging 0.99
IGL03210:Dnah8 APN 17 30815665 missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30673920 splice site probably null
IGL03255:Dnah8 APN 17 30741381 missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30672349 missense probably benign
IGL03348:Dnah8 APN 17 30746986 missense probably damaging 0.99
Alternator UTSW 17 30765635 missense probably benign
armature UTSW 17 30708390 missense probably benign 0.02
Brush UTSW 17 30746990 missense probably damaging 1.00
Dynos UTSW 17 30715509 missense possibly damaging 0.84
joule UTSW 17 30713098 critical splice donor site probably null
solenoid UTSW 17 30741178 missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30635463 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635465 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635477 small deletion probably benign
I2288:Dnah8 UTSW 17 30663454 missense probably benign
P0029:Dnah8 UTSW 17 30765720 missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30708445 missense probably benign 0.04
R0016:Dnah8 UTSW 17 30663316 missense probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30755119 missense probably damaging 1.00
R0090:Dnah8 UTSW 17 30784090 missense probably benign 0.20
R0119:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0184:Dnah8 UTSW 17 30683683 missense probably benign 0.04
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30690271 missense probably benign
R0268:Dnah8 UTSW 17 30769707 missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30736156 missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 30871351 missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30708390 missense probably benign 0.02
R0423:Dnah8 UTSW 17 30701981 missense probably benign
R0470:Dnah8 UTSW 17 30708540 splice site probably benign
R0477:Dnah8 UTSW 17 30755080 missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30700419 missense probably benign
R0499:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30718961 missense probably benign 0.01
R0601:Dnah8 UTSW 17 30708358 missense probably benign 0.06
R0646:Dnah8 UTSW 17 30684173 missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30736155 missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30704662 missense probably benign
R0843:Dnah8 UTSW 17 30813095 missense probably damaging 1.00
R0940:Dnah8 UTSW 17 30803243 missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30673920 splice site probably null
R1102:Dnah8 UTSW 17 30854764 splice site probably null
R1137:Dnah8 UTSW 17 30855936 missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30721000 missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30737295 missense probably damaging 1.00
R1377:Dnah8 UTSW 17 30840622 nonsense probably null
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1497:Dnah8 UTSW 17 30752075 missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30673888 missense probably benign
R1541:Dnah8 UTSW 17 30747247 missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30635664 missense probably benign 0.07
R1634:Dnah8 UTSW 17 30713098 critical splice donor site probably null
R1670:Dnah8 UTSW 17 30725124 missense probably damaging 1.00
R1710:Dnah8 UTSW 17 30854940 missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30769651 missense probably benign 0.28
R1761:Dnah8 UTSW 17 30779916 missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30722937 missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30708407 missense probably benign 0.00
R1808:Dnah8 UTSW 17 30684186 missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30731180 missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 30874927 missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30635505 missense unknown
R1935:Dnah8 UTSW 17 30726896 splice site probably benign
R1940:Dnah8 UTSW 17 30731207 missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30712385 missense probably benign 0.00
R2025:Dnah8 UTSW 17 30731159 missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30758281 missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30635658 missense probably benign 0.01
R2148:Dnah8 UTSW 17 30737258 missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30653393 missense probably benign
R2180:Dnah8 UTSW 17 30840647 missense probably benign 0.00
R2262:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2328:Dnah8 UTSW 17 30794744 missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30771872 missense probably benign
R2357:Dnah8 UTSW 17 30874935 missense probably benign 0.00
R2360:Dnah8 UTSW 17 30677204 missense probably benign 0.22
R2496:Dnah8 UTSW 17 30851731 missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30741365 nonsense probably null
R2509:Dnah8 UTSW 17 30775045 missense probably benign 0.02
R3114:Dnah8 UTSW 17 30833568 missense probably benign 0.04
R3708:Dnah8 UTSW 17 30739657 missense probably damaging 0.98
R3720:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3722:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30739648 nonsense probably null
R3747:Dnah8 UTSW 17 30784174 nonsense probably null
R3748:Dnah8 UTSW 17 30784174 nonsense probably null
R3749:Dnah8 UTSW 17 30784174 nonsense probably null
R3787:Dnah8 UTSW 17 30755041 missense probably damaging 1.00
R3790:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30670647 missense probably benign 0.00
R3857:Dnah8 UTSW 17 30663422 missense probably damaging 0.96
R3898:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3899:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3938:Dnah8 UTSW 17 30854937 missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30694065 splice site probably benign
R4091:Dnah8 UTSW 17 30769839 missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30748559 missense probably benign
R4326:Dnah8 UTSW 17 30752092 missense probably benign 0.04
R4346:Dnah8 UTSW 17 30725098 missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30752146 missense probably damaging 1.00
R4457:Dnah8 UTSW 17 30813151 missense probably benign
R4475:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4565:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4566:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4568:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4573:Dnah8 UTSW 17 30700406 missense probably benign 0.00
R4580:Dnah8 UTSW 17 30662052 missense probably benign 0.00
R4585:Dnah8 UTSW 17 30751567 missense probably benign 0.01
R4611:Dnah8 UTSW 17 30684237 missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30683634 missense probably benign 0.08
R4721:Dnah8 UTSW 17 30725166 missense probably damaging 1.00
R4727:Dnah8 UTSW 17 30851747 missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4732:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4733:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4798:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4814:Dnah8 UTSW 17 30767924 missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4894:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4900:Dnah8 UTSW 17 30746975 missense probably damaging 1.00
R4901:Dnah8 UTSW 17 30840714 critical splice donor site probably null
R4931:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4932:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4933:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4942:Dnah8 UTSW 17 30729142 missense probably benign
R4969:Dnah8 UTSW 17 30723014 missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4977:Dnah8 UTSW 17 30663301 missense probably benign 0.00
R5001:Dnah8 UTSW 17 30787185 missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5013:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5014:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5024:Dnah8 UTSW 17 30736096 missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30739757 critical splice donor site probably null
R5075:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5075:Dnah8 UTSW 17 30800531 missense probably damaging 1.00
R5112:Dnah8 UTSW 17 30731038 missense probably benign 0.02
R5121:Dnah8 UTSW 17 30810353 missense probably benign 0.14
R5138:Dnah8 UTSW 17 30765597 missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30712295 missense probably benign 0.06
R5191:Dnah8 UTSW 17 30746765 missense probably damaging 1.00
R5238:Dnah8 UTSW 17 30790917 missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30700419 missense probably benign
R5358:Dnah8 UTSW 17 30746954 missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5404:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5482:Dnah8 UTSW 17 30800547 missense probably damaging 0.96
R5489:Dnah8 UTSW 17 30790956 missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30752916 missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30706386 missense probably benign 0.00
R5640:Dnah8 UTSW 17 30803108 missense probably damaging 1.00
R5649:Dnah8 UTSW 17 30800587 missense probably benign 0.13
R5662:Dnah8 UTSW 17 30737333 missense probably damaging 1.00
R5673:Dnah8 UTSW 17 30803261 missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5699:Dnah8 UTSW 17 30810324 missense probably benign 0.22
R5737:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5738:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5739:Dnah8 UTSW 17 30719007 missense probably benign 0.00
R5766:Dnah8 UTSW 17 30690261 missense probably benign 0.01
R5790:Dnah8 UTSW 17 30875004 missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30728191 missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 30794763 missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5886:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5887:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30656685 missense probably benign 0.32
R5979:Dnah8 UTSW 17 30815664 nonsense probably null
R5986:Dnah8 UTSW 17 30851630 missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30663305 missense probably benign 0.32
R6042:Dnah8 UTSW 17 30747265 missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6181:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6237:Dnah8 UTSW 17 30747854 nonsense probably null
R6239:Dnah8 UTSW 17 30810359 missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6365:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6416:Dnah8 UTSW 17 30765635 missense probably benign
R6443:Dnah8 UTSW 17 30771885 missense probably benign 0.10
R6478:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6479:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6480:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6481:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6533:Dnah8 UTSW 17 30746990 missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6608:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6610:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6675:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6723:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6724:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6754:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6755:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6759:Dnah8 UTSW 17 30663292 splice site probably null
R6765:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6766:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6778:Dnah8 UTSW 17 30635666 missense probably benign 0.00
R6781:Dnah8 UTSW 17 30765724 frame shift probably null
R6788:Dnah8 UTSW 17 30648465 missense probably benign 0.14
R6814:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30741173 missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30710551 missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30746959 missense probably damaging 1.00
R6944:Dnah8 UTSW 17 30794659 missense probably benign 0.09
R6982:Dnah8 UTSW 17 30767925 missense probably benign 0.03
R6984:Dnah8 UTSW 17 30739738 missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30662091 missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30643275 missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30704724 missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30741178 missense probably damaging 1.00
R7112:Dnah8 UTSW 17 30871392 missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30644617 missense probably benign 0.01
R7146:Dnah8 UTSW 17 30769644 missense possibly damaging 0.90
R7309:Dnah8 UTSW 17 30875014 missense probably damaging 1.00
R7324:Dnah8 UTSW 17 30784125 missense probably benign 0.01
R7373:Dnah8 UTSW 17 30767965 critical splice donor site probably null
R7423:Dnah8 UTSW 17 30704769 missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30706389 missense probably damaging 0.98
R7450:Dnah8 UTSW 17 30787191 missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30775103 missense probably damaging 0.98
R7604:Dnah8 UTSW 17 30813095 missense probably damaging 1.00
R7635:Dnah8 UTSW 17 30785107 missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30649677 missense probably benign 0.00
R7685:Dnah8 UTSW 17 30657973 missense probably damaging 1.00
R7793:Dnah8 UTSW 17 30855944 missense probably benign 0.20
R7827:Dnah8 UTSW 17 30760867 frame shift probably null
R7866:Dnah8 UTSW 17 30874927 missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30663374 missense probably benign
R7891:Dnah8 UTSW 17 30712289 missense probably benign 0.09
R7977:Dnah8 UTSW 17 30744524 missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30744524 missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30741337 nonsense probably null
R8076:Dnah8 UTSW 17 30784153 missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30673823 missense probably damaging 1.00
R8199:Dnah8 UTSW 17 30871419 missense probably benign 0.06
R8253:Dnah8 UTSW 17 30760867 frame shift probably null
R8270:Dnah8 UTSW 17 30840713 missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30765727 missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30769831 missense probably benign 0.12
R8348:Dnah8 UTSW 17 30673840 missense probably benign
R8348:Dnah8 UTSW 17 30736147 missense probably damaging 0.96
R8354:Dnah8 UTSW 17 30643260 missense probably benign 0.17
R8355:Dnah8 UTSW 17 30695178 missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30760867 frame shift probably null
R8448:Dnah8 UTSW 17 30673840 missense probably benign
R8459:Dnah8 UTSW 17 30725247 critical splice donor site probably null
R8462:Dnah8 UTSW 17 30656629 missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30721134 missense probably benign
R8524:Dnah8 UTSW 17 30715498 missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30721110 nonsense probably null
R8698:Dnah8 UTSW 17 30875035 missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30741315 missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30760867 frame shift probably null
R8781:Dnah8 UTSW 17 30725104 missense probably damaging 1.00
R8821:Dnah8 UTSW 17 30794738 missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30762642 missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30708312 missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 30851654 missense probably damaging 0.98
R8994:Dnah8 UTSW 17 30790833 missense probably benign 0.05
R9031:Dnah8 UTSW 17 30737427 missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30756755 missense possibly damaging 0.63
R9105:Dnah8 UTSW 17 30760867 frame shift probably null
R9127:Dnah8 UTSW 17 30760867 frame shift probably null
R9225:Dnah8 UTSW 17 30635673 missense probably benign 0.01
R9280:Dnah8 UTSW 17 30785097 missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30725125 missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30771883 missense probably benign
R9347:Dnah8 UTSW 17 30708359 missense probably benign 0.00
R9393:Dnah8 UTSW 17 30653387 missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 30810323
RF027:Dnah8 UTSW 17 30635476 frame shift probably null
X0001:Dnah8 UTSW 17 30748680 missense probably damaging 1.00
X0013:Dnah8 UTSW 17 30819186 missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30648540 missense probably benign
Z1177:Dnah8 UTSW 17 30694033 missense probably benign
Z1177:Dnah8 UTSW 17 30713095 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTTCGTATCCAATATGCCATGGTTTC -3'
(R):5'- TCATTAGCGCCTCCTAGCAG -3'

Sequencing Primer
(F):5'- CCCTTAGGATTGCAGTTACAGACAG -3'
(R):5'- TTAGCGCCTCCTAGCAGTGAAC -3'
Posted On 2016-04-15