Incidental Mutation 'R4914:Baz2b'
ID379768
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Namebromodomain adjacent to zinc finger domain, 2B
SynonymsD2Ertd794e, 5830435C13Rik
MMRRC Submission 042516-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R4914 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location59899363-60209839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59914043 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1373 (T1373S)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090925
AA Change: T1373S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: T1373S

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112550
AA Change: T1373S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: T1373S

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130637
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152639
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A G 5: 109,678,530 S59P probably damaging Het
Ace G A 11: 105,979,597 V281M probably damaging Het
Ap1b1 C T 11: 5,024,400 T363I possibly damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arhgef1 T A 7: 24,923,839 L436Q probably damaging Het
Atxn2 T A 5: 121,749,096 D276E probably damaging Het
AU040320 A T 4: 126,835,676 K544* probably null Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A G 13: 100,056,336 V1330A probably benign Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cabs1 T C 5: 87,980,437 Y316H probably damaging Het
Carmil2 A G 8: 105,693,543 K908E possibly damaging Het
Ccdc188 C A 16: 18,218,219 P86Q probably benign Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dclk2 A T 3: 86,824,742 probably null Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpp4 A T 2: 62,347,892 M632K probably benign Het
E030030I06Rik G A 10: 22,114,298 T192M possibly damaging Het
Ece2 C T 16: 20,644,070 R582C probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Emc1 C T 4: 139,375,165 R924* probably null Het
Etaa1 A T 11: 17,946,532 S528R probably benign Het
Exoc2 A T 13: 30,876,813 N569K probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw16 C T 9: 109,438,177 V329I probably benign Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fermt1 A G 2: 132,906,840 V621A probably damaging Het
Fnbp4 A G 2: 90,751,169 T189A probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
G6pd2 T A 5: 61,810,329 Y482* probably null Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gper1 A G 5: 139,426,868 I323V probably benign Het
Grm5 C A 7: 88,130,129 R958S probably benign Het
H2-DMb2 A G 17: 34,150,529 T85A probably benign Het
Hgsnat A G 8: 25,964,838 S220P probably damaging Het
Hspa12a A T 19: 58,799,452 M646K probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Jmjd1c A G 10: 67,218,971 N344D probably damaging Het
Kif1c A G 11: 70,708,855 E471G probably damaging Het
Lalba T A 15: 98,482,180 N63I probably benign Het
Mcoln1 T A 8: 3,507,483 L163* probably null Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mpzl2 T A 9: 45,043,848 D114E probably benign Het
Myef2 T A 2: 125,109,739 K259* probably null Het
Myh8 C A 11: 67,292,684 D740E probably damaging Het
Myo1b A T 1: 51,824,208 probably null Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Olfr1369-ps1 A T 13: 21,116,397 Q235L probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr90 T C 17: 37,085,991 Y58C probably damaging Het
Orc1 T C 4: 108,604,558 F584S probably damaging Het
Osgin1 C A 8: 119,442,544 A60D possibly damaging Het
Pde4dip C A 3: 97,715,328 V1522L probably benign Het
Phactr1 A G 13: 43,133,963 T556A possibly damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Ppp1r1a A G 15: 103,537,838 V14A probably damaging Het
Prkcd A T 14: 30,605,438 probably null Het
Ranbp17 T C 11: 33,213,425 S1082G probably benign Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rnf103 T A 6: 71,510,264 F626L possibly damaging Het
Rsrc2 A G 5: 123,739,550 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slain2 T A 5: 72,958,266 M448K probably benign Het
Slc25a54 T C 3: 109,111,079 F292L probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Smg8 T C 11: 87,080,710 E745G probably damaging Het
Smyd1 T G 6: 71,219,337 I322L probably benign Het
Snx13 G A 12: 35,132,033 V694I possibly damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Srprb C A 9: 103,201,948 V747L possibly damaging Het
Stam A G 2: 14,102,416 E16G probably damaging Het
Taar5 A T 10: 23,971,570 I289F possibly damaging Het
Tgif1 C T 17: 70,845,247 R70H probably damaging Het
Tmem2 G A 19: 21,809,289 V472I probably benign Het
Top2a A T 11: 99,002,960 L1036H probably damaging Het
Tph1 T A 7: 46,653,859 I232F probably damaging Het
Ttn T C 2: 76,746,831 T24573A probably damaging Het
Tub C T 7: 109,020,954 R102* probably null Het
Ube2n T A 10: 95,541,745 W129R possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r81 A T 10: 79,270,523 K445M probably null Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Wdr63 A G 3: 146,066,827 I488T probably damaging Het
Zfp157 T C 5: 138,456,295 S252P possibly damaging Het
Zfp605 T A 5: 110,127,701 C228* probably null Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 splice site probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 splice site probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7703:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7851:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7988:Baz2b UTSW 2 59962141 missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59900768 missense probably damaging 1.00
R8084:Baz2b UTSW 2 59962236 missense probably benign
R8343:Baz2b UTSW 2 59901514 missense probably damaging 1.00
R8348:Baz2b UTSW 2 59911793 missense
R8438:Baz2b UTSW 2 59917484 nonsense probably null
R8448:Baz2b UTSW 2 59911793 missense
R8511:Baz2b UTSW 2 59901814 missense probably benign
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Z1188:Baz2b UTSW 2 59977405 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGCTAAAGAGACTGGCGTC -3'
(R):5'- ATGGAATCTTTTACTTTTGTAGGCC -3'

Sequencing Primer
(F):5'- TGTTGCTGAGGGAACGCTCC -3'
(R):5'- CTTTTGTAGGCCTAGAAGAAATTGC -3'
Posted On2016-04-15