Mutagenetix > Incidental Mutations

Incidental Mutation 'R4914:Disp2'

379776

Institutional Source

Beutler Lab

Gene Symbol

Disp2

Ensembl Gene

ENSMUSG00000040035

Gene Name

dispatched RND tramsporter family member 2

Synonyms

B230210L08Rik, DispB

MMRRC Submission

042516-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.872) question?

Stock #

R4914 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118779719-118811293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118790454 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 556 (S556C)

Ref Sequence

ENSEMBL: ENSMUSP00000037136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037547
AA Change: S556C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: S556C

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC
Pfam:MMPL	435	635	9.7e-8	PFAM
Pfam:Sterol-sensing	458	611	9.1e-9	PFAM
transmembrane domain	657	679	N/A	INTRINSIC
low complexity region	682	695	N/A	INTRINSIC
low complexity region	748	761	N/A	INTRINSIC
transmembrane domain	914	936	N/A	INTRINSIC
transmembrane domain	943	965	N/A	INTRINSIC
transmembrane domain	975	997	N/A	INTRINSIC
transmembrane domain	1018	1040	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063975

SMART Domains

Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110843

SMART Domains

Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110846

SMART Domains

Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142072

Meta Mutation Damage Score

0.1044

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	G	5: 109,678,530	S59P	probably damaging	Het
Ace	G	A	11: 105,979,597	V281M	probably damaging	Het
Ap1b1	C	T	11: 5,024,400	T363I	possibly damaging	Het
Apobec2	T	C	17: 48,423,125	E171G	probably benign	Het
Arhgef1	T	A	7: 24,923,839	L436Q	probably damaging	Het
Atxn2	T	A	5: 121,749,096	D276E	probably damaging	Het
AU040320	A	T	4: 126,835,676	K544*	probably null	Het
Baz2b	T	A	2: 59,914,043	T1373S	possibly damaging	Het
Bcas1	T	C	2: 170,378,886	D324G	probably damaging	Het
Bdp1	A	G	13: 100,056,336	V1330A	probably benign	Het
Bfsp1	C	T	2: 143,827,471	R396Q	probably benign	Het
Bpifb9b	T	A	2: 154,314,106		probably null	Het
Cabs1	T	C	5: 87,980,437	Y316H	probably damaging	Het
Carmil2	A	G	8: 105,693,543	K908E	possibly damaging	Het
Ccdc188	C	A	16: 18,218,219	P86Q	probably benign	Het
Cdh26	T	C	2: 178,449,821	S58P	probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dclk2	A	T	3: 86,824,742		probably null	Het
Dennd5a	A	G	7: 109,901,089	F943S	probably damaging	Het
Dpp4	A	T	2: 62,347,892	M632K	probably benign	Het
E030030I06Rik	G	A	10: 22,114,298	T192M	possibly damaging	Het
Ece2	C	T	16: 20,644,070	R582C	probably damaging	Het
Ehbp1	T	C	11: 22,146,592	D299G	probably benign	Het
Emc1	C	T	4: 139,375,165	R924*	probably null	Het
Etaa1	A	T	11: 17,946,532	S528R	probably benign	Het
Exoc2	A	T	13: 30,876,813	N569K	probably benign	Het
Fasn	T	G	11: 120,816,646	N799T	probably benign	Het
Fbxo3	T	G	2: 104,054,966	N388K	probably damaging	Het
Fbxw16	C	T	9: 109,438,177	V329I	probably benign	Het
Fer1l4	T	C	2: 156,031,300	K1287E	probably benign	Het
Fermt1	A	G	2: 132,906,840	V621A	probably damaging	Het
Fnbp4	A	G	2: 90,751,169	T189A	probably benign	Het
Fut8	G	T	12: 77,475,044	A486S	probably damaging	Het
G6pd2	T	A	5: 61,810,329	Y482*	probably null	Het
Gfra1	A	T	19: 58,267,090	S308R	probably damaging	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gper1	A	G	5: 139,426,868	I323V	probably benign	Het
Grm5	C	A	7: 88,130,129	R958S	probably benign	Het
H2-DMb2	A	G	17: 34,150,529	T85A	probably benign	Het
Hgsnat	A	G	8: 25,964,838	S220P	probably damaging	Het
Hspa12a	A	T	19: 58,799,452	M646K	probably damaging	Het
Inpp5f	A	T	7: 128,685,116	D573V	probably damaging	Het
Jmjd1c	A	G	10: 67,218,971	N344D	probably damaging	Het
Kif1c	A	G	11: 70,708,855	E471G	probably damaging	Het
Lalba	T	A	15: 98,482,180	N63I	probably benign	Het
Mcoln1	T	A	8: 3,507,483	L163*	probably null	Het
Mllt1	T	C	17: 56,899,813	T344A	probably benign	Het
Mpzl2	T	A	9: 45,043,848	D114E	probably benign	Het
Myef2	T	A	2: 125,109,739	K259*	probably null	Het
Myh8	C	A	11: 67,292,684	D740E	probably damaging	Het
Myo1b	A	T	1: 51,824,208		probably null	Het
Nfix	T	C	8: 84,771,829	I172V	probably benign	Het
Olfr1369-ps1	A	T	13: 21,116,397	Q235L	probably benign	Het
Olfr1459	T	A	19: 13,145,991	I223L	possibly damaging	Het
Olfr362	A	T	2: 37,105,158	I164N	possibly damaging	Het
Olfr401	A	T	11: 74,121,879	I197F	probably benign	Het
Olfr90	T	C	17: 37,085,991	Y58C	probably damaging	Het
Orc1	T	C	4: 108,604,558	F584S	probably damaging	Het
Osgin1	C	A	8: 119,442,544	A60D	possibly damaging	Het
Pde4dip	C	A	3: 97,715,328	V1522L	probably benign	Het
Phactr1	A	G	13: 43,133,963	T556A	possibly damaging	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Ppm1k	T	A	6: 57,510,777	N354Y	probably damaging	Het
Ppp1r1a	A	G	15: 103,537,838	V14A	probably damaging	Het
Prkcd	A	T	14: 30,605,438		probably null	Het
Ranbp17	T	C	11: 33,213,425	S1082G	probably benign	Het
Rere	T	A	4: 150,619,144	W1528R	probably damaging	Het
Rnf103	T	A	6: 71,510,264	F626L	possibly damaging	Het
Rsrc2	A	G	5: 123,739,550		probably benign	Het
Scin	T	A	12: 40,069,374	I552F	possibly damaging	Het
Scn3a	T	C	2: 65,461,455	N1649S	probably damaging	Het
Slain2	T	A	5: 72,958,266	M448K	probably benign	Het
Slc25a54	T	C	3: 109,111,079	F292L	probably benign	Het
Slc4a1	A	G	11: 102,352,453	V784A	probably damaging	Het
Slco1b2	G	A	6: 141,669,370	V334I	probably benign	Het
Slf2	T	G	19: 44,971,661	D1022E	probably damaging	Het
Smg8	T	C	11: 87,080,710	E745G	probably damaging	Het
Smyd1	T	G	6: 71,219,337	I322L	probably benign	Het
Snx13	G	A	12: 35,132,033	V694I	possibly damaging	Het
Sox6	T	C	7: 115,476,964	D814G	probably damaging	Het
Spag6	A	T	2: 18,745,549	I469F	probably benign	Het
Spsb2	A	C	6: 124,809,748	E148A	probably benign	Het
Srprb	C	A	9: 103,201,948	V747L	possibly damaging	Het
Stam	A	G	2: 14,102,416	E16G	probably damaging	Het
Taar5	A	T	10: 23,971,570	I289F	possibly damaging	Het
Tgif1	C	T	17: 70,845,247	R70H	probably damaging	Het
Tmem2	G	A	19: 21,809,289	V472I	probably benign	Het
Top2a	A	T	11: 99,002,960	L1036H	probably damaging	Het
Tph1	T	A	7: 46,653,859	I232F	probably damaging	Het
Ttn	T	C	2: 76,746,831	T24573A	probably damaging	Het
Tub	C	T	7: 109,020,954	R102*	probably null	Het
Ube2n	T	A	10: 95,541,745	W129R	possibly damaging	Het
Usp8	A	T	2: 126,720,140	K85*	probably null	Het
Vmn2r81	A	T	10: 79,270,523	K445M	probably null	Het
Vps45	T	C	3: 96,019,631	T535A	probably damaging	Het
Wdr63	A	G	3: 146,066,827	I488T	probably damaging	Het
Zfp157	T	C	5: 138,456,295	S252P	possibly damaging	Het
Zfp605	T	A	5: 110,127,701	C228*	probably null	Het
Zfp791	T	A	8: 85,110,951	I95L	probably benign	Het

Other mutations in Disp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Disp2	APN	2	118786278	missense	probably damaging	1.00
IGL00970:Disp2	APN	2	118791793	missense	probably damaging	1.00
IGL01790:Disp2	APN	2	118790880	missense	probably damaging	1.00
IGL01809:Disp2	APN	2	118787264	splice site	probably benign
IGL02069:Disp2	APN	2	118790680	missense	possibly damaging	0.93
IGL02140:Disp2	APN	2	118790869	missense	probably benign
IGL02143:Disp2	APN	2	118789969	missense	probably damaging	1.00
IGL02155:Disp2	APN	2	118791804	missense	probably damaging	1.00
IGL02884:Disp2	APN	2	118787551	splice site	probably benign
IGL03113:Disp2	APN	2	118790778	splice site	probably null
IGL03194:Disp2	APN	2	118787629	missense	probably damaging	1.00
PIT4453001:Disp2	UTSW	2	118787644	missense	probably benign	0.01
R0109:Disp2	UTSW	2	118791816	missense	probably damaging	1.00
R0126:Disp2	UTSW	2	118790338	missense	probably damaging	1.00
R0603:Disp2	UTSW	2	118792006	missense	probably damaging	1.00
R0610:Disp2	UTSW	2	118792236	missense	probably benign	0.02
R0639:Disp2	UTSW	2	118790844	missense	possibly damaging	0.74
R0673:Disp2	UTSW	2	118790844	missense	possibly damaging	0.74
R0755:Disp2	UTSW	2	118789762	missense	probably benign	0.00
R0781:Disp2	UTSW	2	118790439	missense	probably damaging	1.00
R1110:Disp2	UTSW	2	118790439	missense	probably damaging	1.00
R1148:Disp2	UTSW	2	118806418	critical splice donor site	probably null
R1148:Disp2	UTSW	2	118806418	critical splice donor site	probably null
R1243:Disp2	UTSW	2	118791822	missense	probably damaging	1.00
R1587:Disp2	UTSW	2	118791583	missense	probably damaging	1.00
R1739:Disp2	UTSW	2	118791550	missense	probably damaging	1.00
R1771:Disp2	UTSW	2	118791297	nonsense	probably null
R1781:Disp2	UTSW	2	118792561	missense	probably damaging	0.96
R1918:Disp2	UTSW	2	118791927	missense	probably benign
R1956:Disp2	UTSW	2	118792223	missense	probably benign	0.02
R2167:Disp2	UTSW	2	118791685	missense	probably damaging	1.00
R2206:Disp2	UTSW	2	118792244	missense	probably benign	0.02
R4031:Disp2	UTSW	2	118791880	missense	probably benign	0.27
R4617:Disp2	UTSW	2	118790162	missense	probably benign
R4656:Disp2	UTSW	2	118790563	missense	probably damaging	1.00
R4684:Disp2	UTSW	2	118792756	missense	probably damaging	1.00
R4696:Disp2	UTSW	2	118791684	nonsense	probably null
R4697:Disp2	UTSW	2	118791684	nonsense	probably null
R4738:Disp2	UTSW	2	118790326	missense	probably damaging	0.97
R4834:Disp2	UTSW	2	118792504	missense	probably benign	0.09
R4915:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R4918:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R5045:Disp2	UTSW	2	118792062	missense	probably benign	0.03
R5208:Disp2	UTSW	2	118791805	missense	probably damaging	1.00
R5303:Disp2	UTSW	2	118810848	unclassified	probably benign
R5350:Disp2	UTSW	2	118787575	missense	probably benign	0.23
R5355:Disp2	UTSW	2	118786911	missense	probably benign	0.00
R6011:Disp2	UTSW	2	118790820	missense	possibly damaging	0.65
R6031:Disp2	UTSW	2	118789794	missense	probably benign	0.01
R6031:Disp2	UTSW	2	118789794	missense	probably benign	0.01
R6139:Disp2	UTSW	2	118790662	missense	probably damaging	0.97
R6169:Disp2	UTSW	2	118791550	missense	probably damaging	1.00
R6187:Disp2	UTSW	2	118792143	missense	probably damaging	1.00
R6209:Disp2	UTSW	2	118786921	missense	probably damaging	1.00
R6250:Disp2	UTSW	2	118790766	missense	probably damaging	1.00
R6392:Disp2	UTSW	2	118790749	missense	probably damaging	1.00
R7138:Disp2	UTSW	2	118786880	missense	probably benign
R7156:Disp2	UTSW	2	118791811	missense	probably damaging	1.00
R7230:Disp2	UTSW	2	118791805	missense	probably damaging	1.00
R7400:Disp2	UTSW	2	118791886	missense	probably damaging	1.00
R7460:Disp2	UTSW	2	118789780	missense	probably damaging	1.00
R7505:Disp2	UTSW	2	118791088	missense	probably damaging	1.00
R7542:Disp2	UTSW	2	118791118	missense	probably damaging	0.97
R7728:Disp2	UTSW	2	118791480	missense	probably benign	0.31
R7757:Disp2	UTSW	2	118790910	missense	probably damaging	1.00
R7798:Disp2	UTSW	2	118791879	missense	probably benign
R7945:Disp2	UTSW	2	118792789	missense	probably damaging	1.00
R8013:Disp2	UTSW	2	118789682	nonsense	probably null
R8085:Disp2	UTSW	2	118786971	missense	possibly damaging	0.94
R8179:Disp2	UTSW	2	118792549	missense	probably damaging	0.99
R8288:Disp2	UTSW	2	118790281	missense	probably damaging	1.00
R8345:Disp2	UTSW	2	118810803	missense	unknown
R8385:Disp2	UTSW	2	118790410	missense	probably damaging	1.00
R8700:Disp2	UTSW	2	118789859	nonsense	probably null
R8808:Disp2	UTSW	2	118790008	missense	probably damaging	1.00
R8880:Disp2	UTSW	2	118790758	missense	probably damaging	1.00
Z1177:Disp2	UTSW	2	118789702	missense	probably damaging	0.99
Z1177:Disp2	UTSW	2	118790827	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCAATCTAGCGGCTCTCC -3'
(R):5'- TAATGACACCACAGGGCAG -3'

Sequencing Primer
(F):5'- GGCTCTCCTTCTGCTTAGTGG -3'
(R):5'- TCTTGCGAAAAATACGGATCCG -3'

Posted On

2016-04-15