Incidental Mutation 'R4914:Vps45'
ID379786
Institutional Source Beutler Lab
Gene Symbol Vps45
Ensembl Gene ENSMUSG00000015747
Gene Namevacuolar protein sorting 45
SynonymsmVps45
MMRRC Submission 042516-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R4914 (G1)
Quality Score210
Status Not validated
Chromosome3
Chromosomal Location95999832-96058466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96019631 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 535 (T535A)
Ref Sequence ENSEMBL: ENSMUSP00000015891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015891]
Predicted Effect probably damaging
Transcript: ENSMUST00000015891
AA Change: T535A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015891
Gene: ENSMUSG00000015747
AA Change: T535A

DomainStartEndE-ValueType
Pfam:Sec1 23 546 3e-119 PFAM
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec1 domain family, and shows a high degree of sequence similarity to mouse, rat and yeast Vps45. The exact function of this gene is not known, but its high expression in peripheral blood mononuclear cells suggests a role in trafficking proteins, including inflammatory mediators. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A G 5: 109,678,530 S59P probably damaging Het
Ace G A 11: 105,979,597 V281M probably damaging Het
Ap1b1 C T 11: 5,024,400 T363I possibly damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arhgef1 T A 7: 24,923,839 L436Q probably damaging Het
Atxn2 T A 5: 121,749,096 D276E probably damaging Het
AU040320 A T 4: 126,835,676 K544* probably null Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A G 13: 100,056,336 V1330A probably benign Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cabs1 T C 5: 87,980,437 Y316H probably damaging Het
Carmil2 A G 8: 105,693,543 K908E possibly damaging Het
Ccdc188 C A 16: 18,218,219 P86Q probably benign Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dclk2 A T 3: 86,824,742 probably null Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpp4 A T 2: 62,347,892 M632K probably benign Het
E030030I06Rik G A 10: 22,114,298 T192M possibly damaging Het
Ece2 C T 16: 20,644,070 R582C probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Emc1 C T 4: 139,375,165 R924* probably null Het
Etaa1 A T 11: 17,946,532 S528R probably benign Het
Exoc2 A T 13: 30,876,813 N569K probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw16 C T 9: 109,438,177 V329I probably benign Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fermt1 A G 2: 132,906,840 V621A probably damaging Het
Fnbp4 A G 2: 90,751,169 T189A probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
G6pd2 T A 5: 61,810,329 Y482* probably null Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gper1 A G 5: 139,426,868 I323V probably benign Het
Grm5 C A 7: 88,130,129 R958S probably benign Het
H2-DMb2 A G 17: 34,150,529 T85A probably benign Het
Hgsnat A G 8: 25,964,838 S220P probably damaging Het
Hspa12a A T 19: 58,799,452 M646K probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Jmjd1c A G 10: 67,218,971 N344D probably damaging Het
Kif1c A G 11: 70,708,855 E471G probably damaging Het
Lalba T A 15: 98,482,180 N63I probably benign Het
Mcoln1 T A 8: 3,507,483 L163* probably null Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mpzl2 T A 9: 45,043,848 D114E probably benign Het
Myef2 T A 2: 125,109,739 K259* probably null Het
Myh8 C A 11: 67,292,684 D740E probably damaging Het
Myo1b A T 1: 51,824,208 probably null Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Olfr1369-ps1 A T 13: 21,116,397 Q235L probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr90 T C 17: 37,085,991 Y58C probably damaging Het
Orc1 T C 4: 108,604,558 F584S probably damaging Het
Osgin1 C A 8: 119,442,544 A60D possibly damaging Het
Pde4dip C A 3: 97,715,328 V1522L probably benign Het
Phactr1 A G 13: 43,133,963 T556A possibly damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Ppp1r1a A G 15: 103,537,838 V14A probably damaging Het
Prkcd A T 14: 30,605,438 probably null Het
Ranbp17 T C 11: 33,213,425 S1082G probably benign Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rnf103 T A 6: 71,510,264 F626L possibly damaging Het
Rsrc2 A G 5: 123,739,550 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slain2 T A 5: 72,958,266 M448K probably benign Het
Slc25a54 T C 3: 109,111,079 F292L probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Smg8 T C 11: 87,080,710 E745G probably damaging Het
Smyd1 T G 6: 71,219,337 I322L probably benign Het
Snx13 G A 12: 35,132,033 V694I possibly damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Srprb C A 9: 103,201,948 V747L possibly damaging Het
Stam A G 2: 14,102,416 E16G probably damaging Het
Taar5 A T 10: 23,971,570 I289F possibly damaging Het
Tgif1 C T 17: 70,845,247 R70H probably damaging Het
Tmem2 G A 19: 21,809,289 V472I probably benign Het
Top2a A T 11: 99,002,960 L1036H probably damaging Het
Tph1 T A 7: 46,653,859 I232F probably damaging Het
Ttn T C 2: 76,746,831 T24573A probably damaging Het
Tub C T 7: 109,020,954 R102* probably null Het
Ube2n T A 10: 95,541,745 W129R possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r81 A T 10: 79,270,523 K445M probably null Het
Wdr63 A G 3: 146,066,827 I488T probably damaging Het
Zfp157 T C 5: 138,456,295 S252P possibly damaging Het
Zfp605 T A 5: 110,127,701 C228* probably null Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Vps45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Vps45 APN 3 96000066 makesense probably null
IGL00848:Vps45 APN 3 96056973 splice site probably benign
IGL00915:Vps45 APN 3 96046350 critical splice donor site probably null
IGL02143:Vps45 APN 3 96033821 missense probably benign
IGL02143:Vps45 APN 3 96019646 missense probably benign 0.00
IGL02247:Vps45 APN 3 96042924 missense probably damaging 1.00
IGL02598:Vps45 APN 3 96031042 missense probably benign 0.03
IGL03409:Vps45 APN 3 96053089 missense probably benign 0.00
R0943:Vps45 UTSW 3 96057024 missense probably benign 0.02
R1102:Vps45 UTSW 3 96042941 splice site probably benign
R1540:Vps45 UTSW 3 96048346 missense probably damaging 1.00
R1829:Vps45 UTSW 3 96047245 critical splice donor site probably null
R1919:Vps45 UTSW 3 96046440 missense probably benign 0.00
R2113:Vps45 UTSW 3 96047053 missense probably benign 0.05
R2251:Vps45 UTSW 3 96057040 missense probably benign 0.00
R2511:Vps45 UTSW 3 96041445 missense probably benign 0.01
R4752:Vps45 UTSW 3 96048387 missense possibly damaging 0.88
R4806:Vps45 UTSW 3 96046413 missense probably benign 0.01
R4915:Vps45 UTSW 3 96019631 missense probably damaging 0.98
R4917:Vps45 UTSW 3 96019631 missense probably damaging 0.98
R5180:Vps45 UTSW 3 96046371 missense possibly damaging 0.94
R5288:Vps45 UTSW 3 96057774 start codon destroyed probably null 1.00
R5454:Vps45 UTSW 3 96019657 missense probably benign 0.21
R6397:Vps45 UTSW 3 96042852 missense probably benign 0.13
R7247:Vps45 UTSW 3 96041405 missense probably benign 0.02
R7449:Vps45 UTSW 3 96047136 critical splice acceptor site probably null
R7460:Vps45 UTSW 3 96048387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCTAGCAATTCGCCATGG -3'
(R):5'- GGACCTGAGAAATTGAAACTGTGTG -3'

Sequencing Primer
(F):5'- TAGCAATTCGCCATGGCCATG -3'
(R):5'- ATCTTTTATTTGTCGCTAAAAGCCC -3'
Posted On2016-04-15