Incidental Mutation 'R4914:Pde4dip'
ID379787
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission 042516-MU
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4914 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 97715328 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1522 (V1522L)
Ref Sequence ENSEMBL: ENSMUSP00000131170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]
Predicted Effect probably benign
Transcript: ENSMUST00000090750
AA Change: V1522L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: V1522L

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168438
AA Change: V1522L

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: V1522L

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A G 5: 109,678,530 S59P probably damaging Het
Ace G A 11: 105,979,597 V281M probably damaging Het
Ap1b1 C T 11: 5,024,400 T363I possibly damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arhgef1 T A 7: 24,923,839 L436Q probably damaging Het
Atxn2 T A 5: 121,749,096 D276E probably damaging Het
AU040320 A T 4: 126,835,676 K544* probably null Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A G 13: 100,056,336 V1330A probably benign Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cabs1 T C 5: 87,980,437 Y316H probably damaging Het
Carmil2 A G 8: 105,693,543 K908E possibly damaging Het
Ccdc188 C A 16: 18,218,219 P86Q probably benign Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dclk2 A T 3: 86,824,742 probably null Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpp4 A T 2: 62,347,892 M632K probably benign Het
E030030I06Rik G A 10: 22,114,298 T192M possibly damaging Het
Ece2 C T 16: 20,644,070 R582C probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Emc1 C T 4: 139,375,165 R924* probably null Het
Etaa1 A T 11: 17,946,532 S528R probably benign Het
Exoc2 A T 13: 30,876,813 N569K probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw16 C T 9: 109,438,177 V329I probably benign Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fermt1 A G 2: 132,906,840 V621A probably damaging Het
Fnbp4 A G 2: 90,751,169 T189A probably benign Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
G6pd2 T A 5: 61,810,329 Y482* probably null Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gper1 A G 5: 139,426,868 I323V probably benign Het
Grm5 C A 7: 88,130,129 R958S probably benign Het
H2-DMb2 A G 17: 34,150,529 T85A probably benign Het
Hgsnat A G 8: 25,964,838 S220P probably damaging Het
Hspa12a A T 19: 58,799,452 M646K probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Jmjd1c A G 10: 67,218,971 N344D probably damaging Het
Kif1c A G 11: 70,708,855 E471G probably damaging Het
Lalba T A 15: 98,482,180 N63I probably benign Het
Mcoln1 T A 8: 3,507,483 L163* probably null Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mpzl2 T A 9: 45,043,848 D114E probably benign Het
Myef2 T A 2: 125,109,739 K259* probably null Het
Myh8 C A 11: 67,292,684 D740E probably damaging Het
Myo1b A T 1: 51,824,208 probably null Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Olfr1369-ps1 A T 13: 21,116,397 Q235L probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr90 T C 17: 37,085,991 Y58C probably damaging Het
Orc1 T C 4: 108,604,558 F584S probably damaging Het
Osgin1 C A 8: 119,442,544 A60D possibly damaging Het
Phactr1 A G 13: 43,133,963 T556A possibly damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Ppp1r1a A G 15: 103,537,838 V14A probably damaging Het
Prkcd A T 14: 30,605,438 probably null Het
Ranbp17 T C 11: 33,213,425 S1082G probably benign Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rnf103 T A 6: 71,510,264 F626L possibly damaging Het
Rsrc2 A G 5: 123,739,550 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slain2 T A 5: 72,958,266 M448K probably benign Het
Slc25a54 T C 3: 109,111,079 F292L probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Smg8 T C 11: 87,080,710 E745G probably damaging Het
Smyd1 T G 6: 71,219,337 I322L probably benign Het
Snx13 G A 12: 35,132,033 V694I possibly damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Srprb C A 9: 103,201,948 V747L possibly damaging Het
Stam A G 2: 14,102,416 E16G probably damaging Het
Taar5 A T 10: 23,971,570 I289F possibly damaging Het
Tgif1 C T 17: 70,845,247 R70H probably damaging Het
Tmem2 G A 19: 21,809,289 V472I probably benign Het
Top2a A T 11: 99,002,960 L1036H probably damaging Het
Tph1 T A 7: 46,653,859 I232F probably damaging Het
Ttn T C 2: 76,746,831 T24573A probably damaging Het
Tub C T 7: 109,020,954 R102* probably null Het
Ube2n T A 10: 95,541,745 W129R possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r81 A T 10: 79,270,523 K445M probably null Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Wdr63 A G 3: 146,066,827 I488T probably damaging Het
Zfp157 T C 5: 138,456,295 S252P possibly damaging Het
Zfp605 T A 5: 110,127,701 C228* probably null Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97699112 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CGGACTTAGACATCACTCAAGC -3'
(R):5'- AGAGGAGTTCCGTGCACATG -3'

Sequencing Primer
(F):5'- AGCTGAGGGCCTGAACAGTTC -3'
(R):5'- TCCGTGCACATGGAACTC -3'
Posted On2016-04-15