Incidental Mutation 'R0244:Filip1'
ID 37984
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms FILIP, 5730485H21Rik
MMRRC Submission 038482-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R0244 (G1)
Quality Score 209
Status Validated
Chromosome 9
Chromosomal Location 79712376-79920133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79726744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 625 (E625V)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000093811
AA Change: E625V

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: E625V

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172740
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Meta Mutation Damage Score 0.1241 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,806,172 (GRCm39) C434* probably null Het
Adprhl1 A G 8: 13,292,391 (GRCm39) probably benign Het
Ago1 T A 4: 126,357,499 (GRCm39) I59F possibly damaging Het
Arel1 T C 12: 84,967,467 (GRCm39) T786A probably damaging Het
Arhgap26 A G 18: 39,496,184 (GRCm39) K117R probably benign Het
Atp6v0b C T 4: 117,741,819 (GRCm39) G204D probably damaging Het
Bace2 T A 16: 97,237,973 (GRCm39) probably null Het
Bltp2 T A 11: 78,177,317 (GRCm39) probably null Het
Camk4 G A 18: 33,312,678 (GRCm39) probably null Het
Cdh26 C T 2: 178,123,425 (GRCm39) R675C possibly damaging Het
Cep152 T C 2: 125,406,134 (GRCm39) E1466G probably benign Het
Ces3b T C 8: 105,819,267 (GRCm39) F441S probably damaging Het
Cfap52 T C 11: 67,817,208 (GRCm39) T562A possibly damaging Het
Clca3a2 C A 3: 144,519,659 (GRCm39) M238I possibly damaging Het
Cntnap5c A T 17: 58,409,163 (GRCm39) D467V probably damaging Het
Col7a1 T A 9: 108,801,252 (GRCm39) probably null Het
Cstf1 A G 2: 172,219,630 (GRCm39) N247S possibly damaging Het
Dffb G T 4: 154,059,072 (GRCm39) N68K probably benign Het
Dnaaf10 T C 11: 17,179,851 (GRCm39) L284P probably damaging Het
Duox2 C T 2: 122,122,341 (GRCm39) G595S probably benign Het
Eftud2 T A 11: 102,755,551 (GRCm39) I228F probably damaging Het
Elmo3 T C 8: 106,035,803 (GRCm39) V578A probably benign Het
Elp2 A G 18: 24,764,528 (GRCm39) D625G possibly damaging Het
Ep300 C T 15: 81,524,329 (GRCm39) P1386S unknown Het
Fam120b A G 17: 15,637,899 (GRCm39) D610G probably damaging Het
Fastk A T 5: 24,647,176 (GRCm39) probably benign Het
Fbxl6 A G 15: 76,421,391 (GRCm39) S252P probably damaging Het
Fbxo43 T C 15: 36,161,939 (GRCm39) K423E probably damaging Het
Fkbp9 T A 6: 56,833,363 (GRCm39) Y283* probably null Het
Gigyf2 T A 1: 87,306,737 (GRCm39) D142E possibly damaging Het
Gm10142 T C 10: 77,551,848 (GRCm39) probably null Het
Golga5 T C 12: 102,442,447 (GRCm39) V262A probably benign Het
Hectd4 T C 5: 121,467,668 (GRCm39) V2539A probably benign Het
Ica1 G T 6: 8,653,632 (GRCm39) S335* probably null Het
Itga1 A T 13: 115,143,433 (GRCm39) probably benign Het
Itgb1 T C 8: 129,444,166 (GRCm39) probably benign Het
Itpr1 G A 6: 108,450,550 (GRCm39) V1960I probably benign Het
Kcnh4 C T 11: 100,637,758 (GRCm39) G633E probably benign Het
Kprp C T 3: 92,732,718 (GRCm39) V111I probably benign Het
Lamc3 T C 2: 31,830,733 (GRCm39) I1490T probably damaging Het
Lcp1 A T 14: 75,464,441 (GRCm39) D554V possibly damaging Het
Lgi3 A G 14: 70,772,138 (GRCm39) T228A probably benign Het
Lipa A T 19: 34,478,941 (GRCm39) F260I probably damaging Het
Lrriq1 C T 10: 103,051,634 (GRCm39) E373K probably damaging Het
Map6 G A 7: 98,986,043 (GRCm39) G649D probably benign Het
Mccc1 A G 3: 36,044,196 (GRCm39) probably null Het
Mical3 A T 6: 120,934,683 (GRCm39) S1799T probably benign Het
Mmp23 T A 4: 155,736,589 (GRCm39) T151S probably damaging Het
Myo1d T A 11: 80,565,534 (GRCm39) N401I probably damaging Het
Myo9b T A 8: 71,774,457 (GRCm39) S323T probably damaging Het
Nbn G T 4: 15,979,353 (GRCm39) W446L probably benign Het
Nedd1 A T 10: 92,552,127 (GRCm39) probably benign Het
Ngef C A 1: 87,415,684 (GRCm39) probably benign Het
Nup153 A T 13: 46,847,412 (GRCm39) N672K probably benign Het
Or10d1b T A 9: 39,613,469 (GRCm39) I199F probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or4e2 T C 14: 52,687,969 (GRCm39) V33A probably benign Het
Or4f57 T C 2: 111,791,361 (GRCm39) N19S probably benign Het
Pakap T G 4: 57,710,177 (GRCm39) V374G possibly damaging Het
Pdlim3 C A 8: 46,361,497 (GRCm39) probably benign Het
Pmfbp1 G A 8: 110,268,305 (GRCm39) E951K probably damaging Het
Pop1 T A 15: 34,516,037 (GRCm39) C548* probably null Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Ptpdc1 A T 13: 48,739,456 (GRCm39) N658K probably benign Het
Ptprk A C 10: 28,082,221 (GRCm39) E63D possibly damaging Het
Rtf1 C T 2: 119,563,358 (GRCm39) R712W probably damaging Het
Samd7 A C 3: 30,805,222 (GRCm39) T2P probably benign Het
Sft2d1 A G 17: 8,538,254 (GRCm39) T52A probably benign Het
Slc25a26 A G 6: 94,487,814 (GRCm39) H91R probably damaging Het
Slc5a4a A G 10: 76,024,986 (GRCm39) E621G possibly damaging Het
Slf1 A T 13: 77,274,751 (GRCm39) L28* probably null Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Sorcs2 G A 5: 36,554,897 (GRCm39) probably benign Het
Tacc2 T C 7: 130,353,555 (GRCm39) probably benign Het
Tas2r140 A G 6: 133,032,290 (GRCm39) V156A possibly damaging Het
Terf2ip C A 8: 112,744,796 (GRCm39) T371K possibly damaging Het
Tifa C T 3: 127,590,537 (GRCm39) L103F probably damaging Het
Tmco3 A G 8: 13,342,037 (GRCm39) N104D probably damaging Het
Tmem259 T A 10: 79,814,797 (GRCm39) D240V probably damaging Het
Trim60 C T 8: 65,453,700 (GRCm39) R183H probably benign Het
Trps1 T C 15: 50,528,139 (GRCm39) N725D probably damaging Het
Ttn C T 2: 76,645,150 (GRCm39) V12902M probably damaging Het
Ubxn4 G A 1: 128,190,641 (GRCm39) E256K probably benign Het
Unc79 A G 12: 103,079,150 (GRCm39) K1772E probably damaging Het
Vwde C T 6: 13,193,125 (GRCm39) V405I probably benign Het
Wdr18 T A 10: 79,802,242 (GRCm39) D290E probably damaging Het
Wwc2 G A 8: 48,353,756 (GRCm39) A126V probably benign Het
Zfp882 A T 8: 72,667,367 (GRCm39) I105F possibly damaging Het
Zfp942 A T 17: 22,147,553 (GRCm39) C359S probably benign Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79,725,226 (GRCm39) missense probably damaging 1.00
IGL01101:Filip1 APN 9 79,805,528 (GRCm39) missense probably benign 0.44
IGL01301:Filip1 APN 9 79,726,462 (GRCm39) missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79,726,899 (GRCm39) missense probably benign 0.42
IGL02119:Filip1 APN 9 79,725,548 (GRCm39) missense probably benign
IGL02285:Filip1 APN 9 79,727,408 (GRCm39) missense probably damaging 1.00
IGL02395:Filip1 APN 9 79,805,692 (GRCm39) missense probably benign 0.01
IGL03398:Filip1 APN 9 79,726,225 (GRCm39) missense probably benign 0.03
IGL03400:Filip1 APN 9 79,727,755 (GRCm39) missense probably benign 0.01
IGL03404:Filip1 APN 9 79,725,841 (GRCm39) missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79,726,462 (GRCm39) missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79,726,810 (GRCm39) missense probably benign 0.04
R0243:Filip1 UTSW 9 79,726,285 (GRCm39) missense probably damaging 0.98
R0371:Filip1 UTSW 9 79,767,373 (GRCm39) missense probably damaging 1.00
R0399:Filip1 UTSW 9 79,725,592 (GRCm39) missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79,727,571 (GRCm39) missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79,726,672 (GRCm39) missense probably damaging 1.00
R1314:Filip1 UTSW 9 79,727,848 (GRCm39) missense probably damaging 1.00
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1602:Filip1 UTSW 9 79,727,873 (GRCm39) missense probably damaging 0.99
R1801:Filip1 UTSW 9 79,723,128 (GRCm39) missense probably damaging 0.98
R1929:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R1983:Filip1 UTSW 9 79,767,374 (GRCm39) missense probably damaging 1.00
R2066:Filip1 UTSW 9 79,727,498 (GRCm39) missense probably damaging 1.00
R2128:Filip1 UTSW 9 79,726,612 (GRCm39) missense probably damaging 0.99
R2271:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R2411:Filip1 UTSW 9 79,805,715 (GRCm39) missense probably damaging 0.98
R3429:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3430:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3945:Filip1 UTSW 9 79,725,649 (GRCm39) missense probably benign 0.01
R4007:Filip1 UTSW 9 79,726,009 (GRCm39) missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79,723,091 (GRCm39) missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79,727,396 (GRCm39) missense probably benign 0.05
R4837:Filip1 UTSW 9 79,726,741 (GRCm39) missense probably damaging 0.98
R4910:Filip1 UTSW 9 79,725,214 (GRCm39) missense probably benign 0.00
R4929:Filip1 UTSW 9 79,727,029 (GRCm39) missense probably benign 0.07
R5387:Filip1 UTSW 9 79,725,556 (GRCm39) missense probably benign
R5581:Filip1 UTSW 9 79,727,042 (GRCm39) missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79,725,983 (GRCm39) missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79,727,142 (GRCm39) missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79,726,736 (GRCm39) missense probably damaging 0.99
R6273:Filip1 UTSW 9 79,723,168 (GRCm39) missense probably benign 0.01
R6380:Filip1 UTSW 9 79,726,906 (GRCm39) missense probably damaging 0.99
R6385:Filip1 UTSW 9 79,727,813 (GRCm39) missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79,723,121 (GRCm39) missense probably damaging 1.00
R6715:Filip1 UTSW 9 79,726,040 (GRCm39) missense probably benign 0.03
R7047:Filip1 UTSW 9 79,760,916 (GRCm39) missense probably damaging 0.98
R7126:Filip1 UTSW 9 79,805,577 (GRCm39) missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79,727,495 (GRCm39) missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79,725,356 (GRCm39) missense probably benign
R7404:Filip1 UTSW 9 79,727,380 (GRCm39) missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79,727,931 (GRCm39) missense probably benign 0.20
R7866:Filip1 UTSW 9 79,726,225 (GRCm39) missense probably benign 0.03
R7933:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79,725,241 (GRCm39) missense probably damaging 0.97
R8097:Filip1 UTSW 9 79,725,541 (GRCm39) missense probably benign
R8213:Filip1 UTSW 9 79,725,374 (GRCm39) missense probably benign 0.01
R8305:Filip1 UTSW 9 79,727,757 (GRCm39) nonsense probably null
R8798:Filip1 UTSW 9 79,727,372 (GRCm39) missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79,805,542 (GRCm39) missense probably benign 0.03
R9322:Filip1 UTSW 9 79,727,014 (GRCm39) missense probably benign 0.01
R9334:Filip1 UTSW 9 79,725,739 (GRCm39) missense probably benign 0.32
R9353:Filip1 UTSW 9 79,725,623 (GRCm39) missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79,727,135 (GRCm39) nonsense probably null
R9607:Filip1 UTSW 9 79,726,402 (GRCm39) missense probably damaging 1.00
X0054:Filip1 UTSW 9 79,726,817 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTGCTGGGAGAGGAAATTTGCC -3'
(R):5'- CCTCACGAAGCTGAAGTCCTTCAC -3'

Sequencing Primer
(F):5'- GAGAGGAAATTTGCCTTATCCTGC -3'
(R):5'- AGCTGAAGTCCTTCACTGTGATG -3'
Posted On 2013-05-23