Mutagenetix > Incidental Mutation

Incidental Mutation 'R0244:Ptprk'

37987

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

038482-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0244 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 28206225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 63 (E63D)

Ref Sequence

ENSEMBL: ENSMUSP00000126279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]

AlphaFold

P35822

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166468
AA Change: E63D

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: E63D

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218276
AA Change: E63D

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218359
AA Change: E63D

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219478

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219761

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,286,491		probably null	Het
Adamdec1	A	T	14: 68,568,723	C434*	probably null	Het
Adprhl1	A	G	8: 13,242,391		probably benign	Het
Ago1	T	A	4: 126,463,706	I59F	possibly damaging	Het
Arel1	T	C	12: 84,920,693	T786A	probably damaging	Het
Arhgap26	A	G	18: 39,363,131	K117R	probably benign	Het
Atp6v0b	C	T	4: 117,884,622	G204D	probably damaging	Het
Bace2	T	A	16: 97,436,773		probably null	Het
Camk4	G	A	18: 33,179,625		probably null	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cep152	T	C	2: 125,564,214	E1466G	probably benign	Het
Ces3b	T	C	8: 105,092,635	F441S	probably damaging	Het
Cfap52	T	C	11: 67,926,382	T562A	possibly damaging	Het
Clca3a2	C	A	3: 144,813,898	M238I	possibly damaging	Het
Cntnap5c	A	T	17: 58,102,168	D467V	probably damaging	Het
Col7a1	T	A	9: 108,972,184		probably null	Het
Cstf1	A	G	2: 172,377,710	N247S	possibly damaging	Het
Dffb	G	T	4: 153,974,615	N68K	probably benign	Het
Duox2	C	T	2: 122,291,860	G595S	probably benign	Het
Eftud2	T	A	11: 102,864,725	I228F	probably damaging	Het
Elmo3	T	C	8: 105,309,171	V578A	probably benign	Het
Elp2	A	G	18: 24,631,471	D625G	possibly damaging	Het
Ep300	C	T	15: 81,640,128	P1386S	unknown	Het
Fam120b	A	G	17: 15,417,637	D610G	probably damaging	Het
Fastk	A	T	5: 24,442,178		probably benign	Het
Fbxl6	A	G	15: 76,537,191	S252P	probably damaging	Het
Fbxo43	T	C	15: 36,161,793	K423E	probably damaging	Het
Filip1	T	A	9: 79,819,462	E625V	possibly damaging	Het
Fkbp9	T	A	6: 56,856,378	Y283*	probably null	Het
Gigyf2	T	A	1: 87,379,015	D142E	possibly damaging	Het
Gm10142	T	C	10: 77,716,014		probably null	Het
Golga5	T	C	12: 102,476,188	V262A	probably benign	Het
Hectd4	T	C	5: 121,329,605	V2539A	probably benign	Het
Ica1	G	T	6: 8,653,632	S335*	probably null	Het
Itga1	A	T	13: 115,006,897		probably benign	Het
Itgb1	T	C	8: 128,717,685		probably benign	Het
Itpr1	G	A	6: 108,473,589	V1960I	probably benign	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kprp	C	T	3: 92,825,411	V111I	probably benign	Het
Lamc3	T	C	2: 31,940,721	I1490T	probably damaging	Het
Lcp1	A	T	14: 75,227,001	D554V	possibly damaging	Het
Lgi3	A	G	14: 70,534,698	T228A	probably benign	Het
Lipa	A	T	19: 34,501,541	F260I	probably damaging	Het
Lrriq1	C	T	10: 103,215,773	E373K	probably damaging	Het
Map6	G	A	7: 99,336,836	G649D	probably benign	Het
Mccc1	A	G	3: 35,990,047		probably null	Het
Mical3	A	T	6: 120,957,722	S1799T	probably benign	Het
Mmp23	T	A	4: 155,652,132	T151S	probably damaging	Het
Myo1d	T	A	11: 80,674,708	N401I	probably damaging	Het
Myo9b	T	A	8: 71,321,813	S323T	probably damaging	Het
Nbn	G	T	4: 15,979,353	W446L	probably benign	Het
Nedd1	A	T	10: 92,716,265		probably benign	Het
Ngef	C	A	1: 87,487,962		probably benign	Het
Nup153	A	T	13: 46,693,936	N672K	probably benign	Het
Olfr1308	T	C	2: 111,961,016	N19S	probably benign	Het
Olfr149	T	A	9: 39,702,173	I199F	probably damaging	Het
Olfr1509	T	C	14: 52,450,512	V33A	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Palm2	T	G	4: 57,710,177	V374G	possibly damaging	Het
Pdlim3	C	A	8: 45,908,460		probably benign	Het
Pmfbp1	G	A	8: 109,541,673	E951K	probably damaging	Het
Pop1	T	A	15: 34,515,891	C548*	probably null	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ptpdc1	A	T	13: 48,585,980	N658K	probably benign	Het
Rtf1	C	T	2: 119,732,877	R712W	probably damaging	Het
Samd7	A	C	3: 30,751,073	T2P	probably benign	Het
Sft2d1	A	G	17: 8,319,422	T52A	probably benign	Het
Slc25a26	A	G	6: 94,510,833	H91R	probably damaging	Het
Slc5a4a	A	G	10: 76,189,152	E621G	possibly damaging	Het
Slf1	A	T	13: 77,126,632	L28*	probably null	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sorcs2	G	A	5: 36,397,553		probably benign	Het
Tacc2	T	C	7: 130,751,825		probably benign	Het
Tas2r140	A	G	6: 133,055,327	V156A	possibly damaging	Het
Terf2ip	C	A	8: 112,018,164	T371K	possibly damaging	Het
Tifa	C	T	3: 127,796,888	L103F	probably damaging	Het
Tmco3	A	G	8: 13,292,037	N104D	probably damaging	Het
Tmem259	T	A	10: 79,978,963	D240V	probably damaging	Het
Trim60	C	T	8: 65,001,048	R183H	probably benign	Het
Trps1	T	C	15: 50,664,743	N725D	probably damaging	Het
Ttn	C	T	2: 76,814,806	V12902M	probably damaging	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Unc79	A	G	12: 103,112,891	K1772E	probably damaging	Het
Vwde	C	T	6: 13,193,126	V405I	probably benign	Het
Wdr18	T	A	10: 79,966,408	D290E	probably damaging	Het
Wdr92	T	C	11: 17,229,851	L284P	probably damaging	Het
Wwc2	G	A	8: 47,900,721	A126V	probably benign	Het
Zfp882	A	T	8: 71,913,523	I105F	possibly damaging	Het
Zfp942	A	T	17: 21,928,572	C359S	probably benign	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	splice site	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00
R7661:Ptprk	UTSW	10	28466040	missense	probably benign	0.00
R7694:Ptprk	UTSW	10	28589370	missense	possibly damaging	0.63
R7740:Ptprk	UTSW	10	28496924	missense	probably damaging	1.00
R7810:Ptprk	UTSW	10	28592857	missense	probably damaging	0.97
R7831:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7836:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R8049:Ptprk	UTSW	10	28383569	missense	possibly damaging	0.84
R8235:Ptprk	UTSW	10	28589041	missense	possibly damaging	0.70
R8274:Ptprk	UTSW	10	28580412	missense	probably damaging	1.00
R8286:Ptprk	UTSW	10	28568327	missense	probably damaging	1.00
R8372:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R8727:Ptprk	UTSW	10	28566545	unclassified	probably benign
R8794:Ptprk	UTSW	10	28263508	nonsense	probably null
R8842:Ptprk	UTSW	10	28566501	missense	probably damaging	0.97
R8861:Ptprk	UTSW	10	28570190	missense	probably damaging	1.00
R8897:Ptprk	UTSW	10	28591957	missense	probably damaging	1.00
R8910:Ptprk	UTSW	10	28492997	missense	possibly damaging	0.68
R8919:Ptprk	UTSW	10	28483207	nonsense	probably null
R8976:Ptprk	UTSW	10	28585673	missense	probably damaging	1.00
R8982:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R9036:Ptprk	UTSW	10	28585932	missense	probably benign	0.01
R9135:Ptprk	UTSW	10	28580417	missense	probably damaging	1.00
R9308:Ptprk	UTSW	10	28574854	missense	probably benign	0.15
R9317:Ptprk	UTSW	10	28354735	missense	probably damaging	0.96
R9475:Ptprk	UTSW	10	28334480	missense	possibly damaging	0.60
R9585:Ptprk	UTSW	10	28493151	nonsense	probably null
R9625:Ptprk	UTSW	10	28586010	missense	probably damaging	0.99
R9700:Ptprk	UTSW	10	28580499	missense	probably damaging	1.00
R9745:Ptprk	UTSW	10	28263612	missense	possibly damaging	0.46
Z1177:Ptprk	UTSW	10	28493120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTCACCAGGTGCCATTTCC -3'
(R):5'- ACCAACAACTAGTGCTTGCTTAGAGTC -3'

Sequencing Primer
(F):5'- CAGGTGCCATTTCCCTCAG -3'
(R):5'- CCCTAGACATTGAATTAGGGGAA -3'

Posted On

2013-05-23