Incidental Mutation 'R4915:Fry'
ID379924
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 042517-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R4915 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150478863 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 790 (T790S)
Ref Sequence ENSEMBL: ENSMUSP00000144657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
Predicted Effect probably benign
Transcript: ENSMUST00000087204
AA Change: T2800S

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: T2800S

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200863
AA Change: T432S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201196
Predicted Effect probably benign
Transcript: ENSMUST00000202566
AA Change: T790S

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602
AA Change: T790S

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 98% (162/166)
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
1700011H14Rik A T 14: 49,232,894 N189K probably benign Het
2700049A03Rik C T 12: 71,189,646 A1257V possibly damaging Het
Aldh8a1 T C 10: 21,395,763 S463P probably damaging Het
Angptl1 T G 1: 156,844,818 D71E probably benign Het
Ank2 T A 3: 126,942,671 probably benign Het
Ano1 A G 7: 144,611,375 S649P possibly damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Asb15 A T 6: 24,566,293 D415V probably damaging Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bmi1 G A 2: 18,682,332 probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Brd9 A G 13: 73,938,455 E25G probably damaging Het
Btbd7 A T 12: 102,837,787 C331* probably null Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cenpj T C 14: 56,553,718 D328G probably damaging Het
Cherp T C 8: 72,468,397 D255G probably damaging Het
Clec5a T A 6: 40,585,231 probably benign Het
Cntnap2 T C 6: 46,530,035 probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2a22 C A 7: 26,937,770 E196D probably benign Het
Cyp4f18 T A 8: 72,009,054 H63L probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx6 T A 9: 44,612,873 D82E probably damaging Het
Defb42 A G 14: 63,048,341 I57V probably benign Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Dip2c T A 13: 9,621,869 probably null Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dnah12 A T 14: 26,734,570 D816V probably damaging Het
Dpy19l3 T C 7: 35,752,742 probably benign Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Evl G T 12: 108,686,106 R359L probably damaging Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fbxw14 A T 9: 109,274,524 F40Y possibly damaging Het
Fbxw22 A G 9: 109,383,941 F313L probably damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm13030 T A 4: 138,873,928 probably benign Het
Gm37150 C T 9: 72,385,490 noncoding transcript Het
Gm4450 C T 3: 98,450,529 V56M probably damaging Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gm8122 T C 14: 43,234,116 N65S unknown Het
Gnb4 C T 3: 32,585,087 probably benign Het
Gprin1 G T 13: 54,738,073 P796Q probably damaging Het
Grin1 A G 2: 25,298,553 probably benign Het
Helz2 T C 2: 181,232,438 R2088G possibly damaging Het
Ighv6-6 C A 12: 114,434,975 R57L probably damaging Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Iqgap3 T A 3: 88,101,527 I643K possibly damaging Het
Itga11 C A 9: 62,752,248 Y427* probably null Het
Kbtbd8 T G 6: 95,126,534 M388R possibly damaging Het
Kif1a T A 1: 93,074,978 E233V probably benign Het
Krt10 T C 11: 99,387,508 N275S probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
Mapk8ip3 A G 17: 24,909,153 S377P possibly damaging Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Myo1c T G 11: 75,656,309 M1R probably null Het
N4bp2 T A 5: 65,803,504 M506K probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nid1 A G 13: 13,499,586 E850G possibly damaging Het
Nlrp9c T C 7: 26,384,460 T565A probably benign Het
Nomo1 T C 7: 46,044,232 F163L probably benign Het
Nsd1 A G 13: 55,276,528 T1463A probably benign Het
Nsd1 T C 13: 55,247,868 V1197A possibly damaging Het
Nsf G A 11: 103,910,359 probably benign Het
Olfr1010 T C 2: 85,754,121 probably benign Het
Olfr1080 A G 2: 86,554,055 L23P probably damaging Het
Olfr1301 A T 2: 111,754,380 I44F probably benign Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr262 A G 19: 12,241,373 V96A probably benign Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Pcdha6 T A 18: 36,968,457 D234E probably damaging Het
Pcnx C A 12: 81,974,495 F1425L probably benign Het
Pdzd9 T G 7: 120,670,168 N10T possibly damaging Het
Pex6 A T 17: 46,714,056 H345L probably damaging Het
Pfkfb3 G A 2: 11,490,298 Q100* probably null Het
Pgm1 G A 5: 64,100,948 G92E probably damaging Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Plcxd2 C T 16: 45,980,578 W94* probably null Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Rabep2 T C 7: 126,444,922 S517P probably damaging Het
Rabgap1l A G 1: 160,441,842 I717T probably benign Het
Rasef A G 4: 73,731,459 C484R probably damaging Het
Rdh19 A G 10: 127,850,244 D75G probably benign Het
Rpl21-ps10 T C 3: 38,107,468 noncoding transcript Het
Rsl1d1 A T 16: 11,199,729 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rwdd1 T C 10: 34,009,078 D62G possibly damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc24a1 A T 9: 64,947,931 F565I unknown Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Sox6 T C 7: 115,476,964 D814G probably damaging Het
Spata4 T C 8: 54,602,436 probably null Het
Spats2l A T 1: 57,902,188 K202M probably damaging Het
Speer4b C T 5: 27,500,136 E80K probably benign Het
Sqle T G 15: 59,321,369 Y198* probably null Het
Srek1 T C 13: 103,752,563 probably benign Het
Srek1 T C 13: 103,752,686 probably benign Het
St14 G A 9: 31,108,664 R50* probably null Het
Tcaf1 A G 6: 42,675,196 V784A probably damaging Het
Tfr2 C T 5: 137,583,411 R587W probably damaging Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Trrap A T 5: 144,805,735 I1101F probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttpal G A 2: 163,607,477 R84H probably damaging Het
Tyk2 T C 9: 21,111,137 T799A probably benign Het
Ugt1a10 A T 1: 88,055,924 D148V probably damaging Het
Usp29 C T 7: 6,961,505 P116S probably benign Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Het
Vmn1r90 T G 7: 14,562,025 R49S possibly damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Yars A T 4: 129,210,591 probably benign Het
Zfp114 T C 7: 24,177,865 L44P probably damaging Het
Zfp36l2 A G 17: 84,186,262 probably benign Het
Zfp512 T C 5: 31,476,865 S407P probably damaging Het
Zfp574 C T 7: 25,080,726 P391L probably damaging Het
Zfp607a T G 7: 27,878,560 C352G probably benign Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Zfr A C 15: 12,162,112 probably null Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
Brook UTSW 5 150326132 missense probably damaging 1.00
miracle UTSW 5 150437159 missense probably damaging 0.99
quickening UTSW 5 150434776 missense probably damaging 1.00
seasons UTSW 5 150466437 missense probably benign 0.06
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense
R4733:Fry UTSW 5 150386007 missense
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
R7491:Fry UTSW 5 150466326 missense
R7574:Fry UTSW 5 150380894 missense probably benign 0.00
R7582:Fry UTSW 5 150496382 missense
R7586:Fry UTSW 5 150426218 missense probably damaging 1.00
R7650:Fry UTSW 5 150413418 missense probably damaging 1.00
R7699:Fry UTSW 5 150405327 missense probably damaging 0.98
R7700:Fry UTSW 5 150405327 missense probably damaging 0.98
R7972:Fry UTSW 5 150310396 missense probably benign 0.05
R8058:Fry UTSW 5 150495767 missense
R8070:Fry UTSW 5 150478007 missense
R8159:Fry UTSW 5 150399533 missense probably benign 0.31
R8202:Fry UTSW 5 150431737 missense probably damaging 1.00
R8261:Fry UTSW 5 150445907 missense probably damaging 1.00
R8279:Fry UTSW 5 150496261 missense
R8338:Fry UTSW 5 150359051 missense probably damaging 0.99
R8370:Fry UTSW 5 150395819 missense probably damaging 1.00
R8673:Fry UTSW 5 150395111 missense possibly damaging 0.91
R8786:Fry UTSW 5 150394036 missense probably benign 0.00
R8815:Fry UTSW 5 150394138 missense possibly damaging 0.80
R8847:Fry UTSW 5 150386007 missense
Z1177:Fry UTSW 5 150310437 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTGAAGCCAAATCCATTCCTTAC -3'
(R):5'- TGACTCTGAAGTAGGAACTGGC -3'

Sequencing Primer
(F):5'- GAAGCCAAATCCATTCCTTACTTCTC -3'
(R):5'- CTCTGAAGTAGGAACTGGCAATACAC -3'
Posted On2016-04-15