Incidental Mutation 'R0244:Lrriq1'
ID 37993
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms Gm1557, LOC380658, 4930503E15Rik
MMRRC Submission 038482-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R0244 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 102881892-103072183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103051634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 373 (E373K)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect probably damaging
Transcript: ENSMUST00000020043
AA Change: E373K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: E373K

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123364
AA Change: E373K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: E373K

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166240
AA Change: E373K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: E373K

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220380
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,806,172 (GRCm39) C434* probably null Het
Adprhl1 A G 8: 13,292,391 (GRCm39) probably benign Het
Ago1 T A 4: 126,357,499 (GRCm39) I59F possibly damaging Het
Arel1 T C 12: 84,967,467 (GRCm39) T786A probably damaging Het
Arhgap26 A G 18: 39,496,184 (GRCm39) K117R probably benign Het
Atp6v0b C T 4: 117,741,819 (GRCm39) G204D probably damaging Het
Bace2 T A 16: 97,237,973 (GRCm39) probably null Het
Bltp2 T A 11: 78,177,317 (GRCm39) probably null Het
Camk4 G A 18: 33,312,678 (GRCm39) probably null Het
Cdh26 C T 2: 178,123,425 (GRCm39) R675C possibly damaging Het
Cep152 T C 2: 125,406,134 (GRCm39) E1466G probably benign Het
Ces3b T C 8: 105,819,267 (GRCm39) F441S probably damaging Het
Cfap52 T C 11: 67,817,208 (GRCm39) T562A possibly damaging Het
Clca3a2 C A 3: 144,519,659 (GRCm39) M238I possibly damaging Het
Cntnap5c A T 17: 58,409,163 (GRCm39) D467V probably damaging Het
Col7a1 T A 9: 108,801,252 (GRCm39) probably null Het
Cstf1 A G 2: 172,219,630 (GRCm39) N247S possibly damaging Het
Dffb G T 4: 154,059,072 (GRCm39) N68K probably benign Het
Dnaaf10 T C 11: 17,179,851 (GRCm39) L284P probably damaging Het
Duox2 C T 2: 122,122,341 (GRCm39) G595S probably benign Het
Eftud2 T A 11: 102,755,551 (GRCm39) I228F probably damaging Het
Elmo3 T C 8: 106,035,803 (GRCm39) V578A probably benign Het
Elp2 A G 18: 24,764,528 (GRCm39) D625G possibly damaging Het
Ep300 C T 15: 81,524,329 (GRCm39) P1386S unknown Het
Fam120b A G 17: 15,637,899 (GRCm39) D610G probably damaging Het
Fastk A T 5: 24,647,176 (GRCm39) probably benign Het
Fbxl6 A G 15: 76,421,391 (GRCm39) S252P probably damaging Het
Fbxo43 T C 15: 36,161,939 (GRCm39) K423E probably damaging Het
Filip1 T A 9: 79,726,744 (GRCm39) E625V possibly damaging Het
Fkbp9 T A 6: 56,833,363 (GRCm39) Y283* probably null Het
Gigyf2 T A 1: 87,306,737 (GRCm39) D142E possibly damaging Het
Gm10142 T C 10: 77,551,848 (GRCm39) probably null Het
Golga5 T C 12: 102,442,447 (GRCm39) V262A probably benign Het
Hectd4 T C 5: 121,467,668 (GRCm39) V2539A probably benign Het
Ica1 G T 6: 8,653,632 (GRCm39) S335* probably null Het
Itga1 A T 13: 115,143,433 (GRCm39) probably benign Het
Itgb1 T C 8: 129,444,166 (GRCm39) probably benign Het
Itpr1 G A 6: 108,450,550 (GRCm39) V1960I probably benign Het
Kcnh4 C T 11: 100,637,758 (GRCm39) G633E probably benign Het
Kprp C T 3: 92,732,718 (GRCm39) V111I probably benign Het
Lamc3 T C 2: 31,830,733 (GRCm39) I1490T probably damaging Het
Lcp1 A T 14: 75,464,441 (GRCm39) D554V possibly damaging Het
Lgi3 A G 14: 70,772,138 (GRCm39) T228A probably benign Het
Lipa A T 19: 34,478,941 (GRCm39) F260I probably damaging Het
Map6 G A 7: 98,986,043 (GRCm39) G649D probably benign Het
Mccc1 A G 3: 36,044,196 (GRCm39) probably null Het
Mical3 A T 6: 120,934,683 (GRCm39) S1799T probably benign Het
Mmp23 T A 4: 155,736,589 (GRCm39) T151S probably damaging Het
Myo1d T A 11: 80,565,534 (GRCm39) N401I probably damaging Het
Myo9b T A 8: 71,774,457 (GRCm39) S323T probably damaging Het
Nbn G T 4: 15,979,353 (GRCm39) W446L probably benign Het
Nedd1 A T 10: 92,552,127 (GRCm39) probably benign Het
Ngef C A 1: 87,415,684 (GRCm39) probably benign Het
Nup153 A T 13: 46,847,412 (GRCm39) N672K probably benign Het
Or10d1b T A 9: 39,613,469 (GRCm39) I199F probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or4e2 T C 14: 52,687,969 (GRCm39) V33A probably benign Het
Or4f57 T C 2: 111,791,361 (GRCm39) N19S probably benign Het
Pakap T G 4: 57,710,177 (GRCm39) V374G possibly damaging Het
Pdlim3 C A 8: 46,361,497 (GRCm39) probably benign Het
Pmfbp1 G A 8: 110,268,305 (GRCm39) E951K probably damaging Het
Pop1 T A 15: 34,516,037 (GRCm39) C548* probably null Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Ptpdc1 A T 13: 48,739,456 (GRCm39) N658K probably benign Het
Ptprk A C 10: 28,082,221 (GRCm39) E63D possibly damaging Het
Rtf1 C T 2: 119,563,358 (GRCm39) R712W probably damaging Het
Samd7 A C 3: 30,805,222 (GRCm39) T2P probably benign Het
Sft2d1 A G 17: 8,538,254 (GRCm39) T52A probably benign Het
Slc25a26 A G 6: 94,487,814 (GRCm39) H91R probably damaging Het
Slc5a4a A G 10: 76,024,986 (GRCm39) E621G possibly damaging Het
Slf1 A T 13: 77,274,751 (GRCm39) L28* probably null Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Sorcs2 G A 5: 36,554,897 (GRCm39) probably benign Het
Tacc2 T C 7: 130,353,555 (GRCm39) probably benign Het
Tas2r140 A G 6: 133,032,290 (GRCm39) V156A possibly damaging Het
Terf2ip C A 8: 112,744,796 (GRCm39) T371K possibly damaging Het
Tifa C T 3: 127,590,537 (GRCm39) L103F probably damaging Het
Tmco3 A G 8: 13,342,037 (GRCm39) N104D probably damaging Het
Tmem259 T A 10: 79,814,797 (GRCm39) D240V probably damaging Het
Trim60 C T 8: 65,453,700 (GRCm39) R183H probably benign Het
Trps1 T C 15: 50,528,139 (GRCm39) N725D probably damaging Het
Ttn C T 2: 76,645,150 (GRCm39) V12902M probably damaging Het
Ubxn4 G A 1: 128,190,641 (GRCm39) E256K probably benign Het
Unc79 A G 12: 103,079,150 (GRCm39) K1772E probably damaging Het
Vwde C T 6: 13,193,125 (GRCm39) V405I probably benign Het
Wdr18 T A 10: 79,802,242 (GRCm39) D290E probably damaging Het
Wwc2 G A 8: 48,353,756 (GRCm39) A126V probably benign Het
Zfp882 A T 8: 72,667,367 (GRCm39) I105F possibly damaging Het
Zfp942 A T 17: 22,147,553 (GRCm39) C359S probably benign Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 102,997,757 (GRCm39) missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103,053,977 (GRCm39) nonsense probably null
IGL01637:Lrriq1 APN 10 103,051,489 (GRCm39) missense probably benign
IGL02019:Lrriq1 APN 10 103,014,661 (GRCm39) missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103,006,340 (GRCm39) missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103,060,802 (GRCm39) missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103,070,024 (GRCm39) splice site probably benign
IGL02408:Lrriq1 APN 10 102,982,142 (GRCm39) missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103,036,500 (GRCm39) missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103,050,880 (GRCm39) missense probably benign 0.02
IGL02558:Lrriq1 APN 10 102,982,144 (GRCm39) missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 102,980,409 (GRCm39) missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103,057,322 (GRCm39) critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103,063,057 (GRCm39) missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 102,907,055 (GRCm39) missense probably benign 0.26
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103,006,281 (GRCm39) critical splice donor site probably null
R0323:Lrriq1 UTSW 10 103,057,150 (GRCm39) missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 102,904,829 (GRCm39) splice site probably null
R0522:Lrriq1 UTSW 10 102,997,638 (GRCm39) missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103,069,905 (GRCm39) missense probably benign
R1220:Lrriq1 UTSW 10 102,906,990 (GRCm39) missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103,038,376 (GRCm39) splice site probably benign
R1642:Lrriq1 UTSW 10 103,050,317 (GRCm39) missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103,050,685 (GRCm39) missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103,006,509 (GRCm39) nonsense probably null
R1830:Lrriq1 UTSW 10 102,997,620 (GRCm39) missense probably benign
R1843:Lrriq1 UTSW 10 103,063,034 (GRCm39) splice site probably null
R2128:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2199:Lrriq1 UTSW 10 102,904,774 (GRCm39) missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103,025,848 (GRCm39) missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103,038,242 (GRCm39) missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103,050,536 (GRCm39) missense probably benign 0.00
R2939:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R3081:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103,006,294 (GRCm39) missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103,006,717 (GRCm39) missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103,051,967 (GRCm39) missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103,038,225 (GRCm39) missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103,057,288 (GRCm39) missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103,036,424 (GRCm39) nonsense probably null
R4663:Lrriq1 UTSW 10 102,899,273 (GRCm39) missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103,051,610 (GRCm39) missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103,006,327 (GRCm39) missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4815:Lrriq1 UTSW 10 102,980,739 (GRCm39) missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103,014,649 (GRCm39) missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103,069,899 (GRCm39) missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 102,997,613 (GRCm39) missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103,023,314 (GRCm39) missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103,051,206 (GRCm39) missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103,050,448 (GRCm39) missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103,006,457 (GRCm39) missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103,051,301 (GRCm39) missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103,009,236 (GRCm39) missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103,057,243 (GRCm39) nonsense probably null
R6008:Lrriq1 UTSW 10 103,006,325 (GRCm39) missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103,051,395 (GRCm39) missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103,051,618 (GRCm39) missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103,051,312 (GRCm39) missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103,009,254 (GRCm39) missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103,036,559 (GRCm39) missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103,063,045 (GRCm39) missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103,057,293 (GRCm39) missense probably benign 0.06
R6719:Lrriq1 UTSW 10 102,906,977 (GRCm39) missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103,017,750 (GRCm39) critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103,050,800 (GRCm39) missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103,023,319 (GRCm39) missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103,060,826 (GRCm39) missense probably benign
R7241:Lrriq1 UTSW 10 103,051,834 (GRCm39) missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103,059,611 (GRCm39) missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103,051,877 (GRCm39) missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103,057,185 (GRCm39) missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103,050,380 (GRCm39) missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103,050,807 (GRCm39) missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103,036,432 (GRCm39) missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103,036,462 (GRCm39) missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103,051,815 (GRCm39) missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103,051,678 (GRCm39) missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103,051,055 (GRCm39) nonsense probably null
R8131:Lrriq1 UTSW 10 103,051,572 (GRCm39) missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 102,992,196 (GRCm39) critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103,006,408 (GRCm39) missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103,069,929 (GRCm39) missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103,050,914 (GRCm39) missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 102,882,016 (GRCm39) missense
R9013:Lrriq1 UTSW 10 103,050,931 (GRCm39) missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103,051,864 (GRCm39) missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103,050,640 (GRCm39) missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103,057,144 (GRCm39) missense probably benign
R9384:Lrriq1 UTSW 10 103,006,458 (GRCm39) missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103,051,250 (GRCm39) missense probably benign
R9706:Lrriq1 UTSW 10 102,881,902 (GRCm39) missense
R9780:Lrriq1 UTSW 10 103,025,824 (GRCm39) missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103,051,565 (GRCm39) nonsense probably null
Z1088:Lrriq1 UTSW 10 103,038,307 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,069,946 (GRCm39) missense probably damaging 0.99
Z1176:Lrriq1 UTSW 10 103,038,221 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,038,220 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAATAGCTTGCTGCTTGCC -3'
(R):5'- AGAGCACTTTCACCCGTCATTTAGG -3'

Sequencing Primer
(F):5'- TAATGATCAGTGGCGAGTGG -3'
(R):5'- GGCACGTTTATTCAAACTGCG -3'
Posted On 2013-05-23