Incidental Mutation 'R0244:Cfap52'
ID 37995
Institutional Source Beutler Lab
Gene Symbol Cfap52
Ensembl Gene ENSMUSG00000020904
Gene Name cilia and flagella associated protein 52
Synonyms Wdr16, 4933417B11Rik, 1700019F09Rik
MMRRC Submission 038482-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.772) question?
Stock # R0244 (G1)
Quality Score 201
Status Validated
Chromosome 11
Chromosomal Location 67815632-67856477 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67817208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 562 (T562A)
Ref Sequence ENSEMBL: ENSMUSP00000021287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021287] [ENSMUST00000021288] [ENSMUST00000108677]
AlphaFold Q5F201
Predicted Effect possibly damaging
Transcript: ENSMUST00000021287
AA Change: T562A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021287
Gene: ENSMUSG00000020904
AA Change: T562A

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
WD40 321 360 6.6e1 SMART
WD40 363 402 8.56e0 SMART
WD40 405 445 2.27e-3 SMART
WD40 450 489 3.14e-6 SMART
WD40 492 530 9.21e0 SMART
WD40 533 573 6.19e-5 SMART
WD40 576 615 2.15e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021288
SMART Domains Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 707 2.8e-61 PFAM
Pfam:UCH_1 101 297 1.3e-6 PFAM
Pfam:UCH_1 503 689 5.2e-13 PFAM
low complexity region 717 731 N/A INTRINSIC
low complexity region 958 972 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068548
Predicted Effect probably benign
Transcript: ENSMUST00000108677
SMART Domains Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 702 3.5e-54 PFAM
Pfam:UCH_1 101 298 2.7e-7 PFAM
Pfam:UCH_1 503 684 1.2e-9 PFAM
low complexity region 712 726 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142929
Meta Mutation Damage Score 0.3588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,806,172 (GRCm39) C434* probably null Het
Adprhl1 A G 8: 13,292,391 (GRCm39) probably benign Het
Ago1 T A 4: 126,357,499 (GRCm39) I59F possibly damaging Het
Arel1 T C 12: 84,967,467 (GRCm39) T786A probably damaging Het
Arhgap26 A G 18: 39,496,184 (GRCm39) K117R probably benign Het
Atp6v0b C T 4: 117,741,819 (GRCm39) G204D probably damaging Het
Bace2 T A 16: 97,237,973 (GRCm39) probably null Het
Bltp2 T A 11: 78,177,317 (GRCm39) probably null Het
Camk4 G A 18: 33,312,678 (GRCm39) probably null Het
Cdh26 C T 2: 178,123,425 (GRCm39) R675C possibly damaging Het
Cep152 T C 2: 125,406,134 (GRCm39) E1466G probably benign Het
Ces3b T C 8: 105,819,267 (GRCm39) F441S probably damaging Het
Clca3a2 C A 3: 144,519,659 (GRCm39) M238I possibly damaging Het
Cntnap5c A T 17: 58,409,163 (GRCm39) D467V probably damaging Het
Col7a1 T A 9: 108,801,252 (GRCm39) probably null Het
Cstf1 A G 2: 172,219,630 (GRCm39) N247S possibly damaging Het
Dffb G T 4: 154,059,072 (GRCm39) N68K probably benign Het
Dnaaf10 T C 11: 17,179,851 (GRCm39) L284P probably damaging Het
Duox2 C T 2: 122,122,341 (GRCm39) G595S probably benign Het
Eftud2 T A 11: 102,755,551 (GRCm39) I228F probably damaging Het
Elmo3 T C 8: 106,035,803 (GRCm39) V578A probably benign Het
Elp2 A G 18: 24,764,528 (GRCm39) D625G possibly damaging Het
Ep300 C T 15: 81,524,329 (GRCm39) P1386S unknown Het
Fam120b A G 17: 15,637,899 (GRCm39) D610G probably damaging Het
Fastk A T 5: 24,647,176 (GRCm39) probably benign Het
Fbxl6 A G 15: 76,421,391 (GRCm39) S252P probably damaging Het
Fbxo43 T C 15: 36,161,939 (GRCm39) K423E probably damaging Het
Filip1 T A 9: 79,726,744 (GRCm39) E625V possibly damaging Het
Fkbp9 T A 6: 56,833,363 (GRCm39) Y283* probably null Het
Gigyf2 T A 1: 87,306,737 (GRCm39) D142E possibly damaging Het
Gm10142 T C 10: 77,551,848 (GRCm39) probably null Het
Golga5 T C 12: 102,442,447 (GRCm39) V262A probably benign Het
Hectd4 T C 5: 121,467,668 (GRCm39) V2539A probably benign Het
Ica1 G T 6: 8,653,632 (GRCm39) S335* probably null Het
Itga1 A T 13: 115,143,433 (GRCm39) probably benign Het
Itgb1 T C 8: 129,444,166 (GRCm39) probably benign Het
Itpr1 G A 6: 108,450,550 (GRCm39) V1960I probably benign Het
Kcnh4 C T 11: 100,637,758 (GRCm39) G633E probably benign Het
Kprp C T 3: 92,732,718 (GRCm39) V111I probably benign Het
Lamc3 T C 2: 31,830,733 (GRCm39) I1490T probably damaging Het
Lcp1 A T 14: 75,464,441 (GRCm39) D554V possibly damaging Het
Lgi3 A G 14: 70,772,138 (GRCm39) T228A probably benign Het
Lipa A T 19: 34,478,941 (GRCm39) F260I probably damaging Het
Lrriq1 C T 10: 103,051,634 (GRCm39) E373K probably damaging Het
Map6 G A 7: 98,986,043 (GRCm39) G649D probably benign Het
Mccc1 A G 3: 36,044,196 (GRCm39) probably null Het
Mical3 A T 6: 120,934,683 (GRCm39) S1799T probably benign Het
Mmp23 T A 4: 155,736,589 (GRCm39) T151S probably damaging Het
Myo1d T A 11: 80,565,534 (GRCm39) N401I probably damaging Het
Myo9b T A 8: 71,774,457 (GRCm39) S323T probably damaging Het
Nbn G T 4: 15,979,353 (GRCm39) W446L probably benign Het
Nedd1 A T 10: 92,552,127 (GRCm39) probably benign Het
Ngef C A 1: 87,415,684 (GRCm39) probably benign Het
Nup153 A T 13: 46,847,412 (GRCm39) N672K probably benign Het
Or10d1b T A 9: 39,613,469 (GRCm39) I199F probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or4e2 T C 14: 52,687,969 (GRCm39) V33A probably benign Het
Or4f57 T C 2: 111,791,361 (GRCm39) N19S probably benign Het
Pakap T G 4: 57,710,177 (GRCm39) V374G possibly damaging Het
Pdlim3 C A 8: 46,361,497 (GRCm39) probably benign Het
Pmfbp1 G A 8: 110,268,305 (GRCm39) E951K probably damaging Het
Pop1 T A 15: 34,516,037 (GRCm39) C548* probably null Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Ptpdc1 A T 13: 48,739,456 (GRCm39) N658K probably benign Het
Ptprk A C 10: 28,082,221 (GRCm39) E63D possibly damaging Het
Rtf1 C T 2: 119,563,358 (GRCm39) R712W probably damaging Het
Samd7 A C 3: 30,805,222 (GRCm39) T2P probably benign Het
Sft2d1 A G 17: 8,538,254 (GRCm39) T52A probably benign Het
Slc25a26 A G 6: 94,487,814 (GRCm39) H91R probably damaging Het
Slc5a4a A G 10: 76,024,986 (GRCm39) E621G possibly damaging Het
Slf1 A T 13: 77,274,751 (GRCm39) L28* probably null Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Sorcs2 G A 5: 36,554,897 (GRCm39) probably benign Het
Tacc2 T C 7: 130,353,555 (GRCm39) probably benign Het
Tas2r140 A G 6: 133,032,290 (GRCm39) V156A possibly damaging Het
Terf2ip C A 8: 112,744,796 (GRCm39) T371K possibly damaging Het
Tifa C T 3: 127,590,537 (GRCm39) L103F probably damaging Het
Tmco3 A G 8: 13,342,037 (GRCm39) N104D probably damaging Het
Tmem259 T A 10: 79,814,797 (GRCm39) D240V probably damaging Het
Trim60 C T 8: 65,453,700 (GRCm39) R183H probably benign Het
Trps1 T C 15: 50,528,139 (GRCm39) N725D probably damaging Het
Ttn C T 2: 76,645,150 (GRCm39) V12902M probably damaging Het
Ubxn4 G A 1: 128,190,641 (GRCm39) E256K probably benign Het
Unc79 A G 12: 103,079,150 (GRCm39) K1772E probably damaging Het
Vwde C T 6: 13,193,125 (GRCm39) V405I probably benign Het
Wdr18 T A 10: 79,802,242 (GRCm39) D290E probably damaging Het
Wwc2 G A 8: 48,353,756 (GRCm39) A126V probably benign Het
Zfp882 A T 8: 72,667,367 (GRCm39) I105F possibly damaging Het
Zfp942 A T 17: 22,147,553 (GRCm39) C359S probably benign Het
Other mutations in Cfap52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Cfap52 APN 11 67,844,406 (GRCm39) missense possibly damaging 0.67
IGL02034:Cfap52 APN 11 67,837,118 (GRCm39) splice site probably null
IGL02530:Cfap52 APN 11 67,845,007 (GRCm39) splice site probably benign
IGL02558:Cfap52 APN 11 67,844,964 (GRCm39) missense probably benign 0.31
IGL02873:Cfap52 APN 11 67,822,608 (GRCm39) missense probably damaging 1.00
IGL02887:Cfap52 APN 11 67,844,341 (GRCm39) missense probably damaging 1.00
IGL02956:Cfap52 APN 11 67,844,901 (GRCm39) missense probably benign
IGL03068:Cfap52 APN 11 67,826,682 (GRCm39) missense probably benign 0.11
IGL03216:Cfap52 APN 11 67,844,932 (GRCm39) missense possibly damaging 0.81
IGL03287:Cfap52 APN 11 67,826,802 (GRCm39) unclassified probably benign
IGL03370:Cfap52 APN 11 67,829,881 (GRCm39) missense probably damaging 0.98
chewbacca UTSW 11 67,815,951 (GRCm39) missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67,815,951 (GRCm39) missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67,815,951 (GRCm39) missense possibly damaging 0.95
R0306:Cfap52 UTSW 11 67,844,896 (GRCm39) missense probably benign
R0364:Cfap52 UTSW 11 67,844,436 (GRCm39) missense possibly damaging 0.80
R0440:Cfap52 UTSW 11 67,844,914 (GRCm39) missense probably benign
R0565:Cfap52 UTSW 11 67,840,425 (GRCm39) missense probably benign 0.00
R1068:Cfap52 UTSW 11 67,829,830 (GRCm39) missense probably benign 0.10
R1082:Cfap52 UTSW 11 67,815,998 (GRCm39) missense probably damaging 0.99
R1509:Cfap52 UTSW 11 67,829,819 (GRCm39) missense probably benign 0.00
R1894:Cfap52 UTSW 11 67,844,445 (GRCm39) critical splice acceptor site probably null
R2994:Cfap52 UTSW 11 67,830,617 (GRCm39) missense probably benign
R3954:Cfap52 UTSW 11 67,821,691 (GRCm39) missense probably benign
R4611:Cfap52 UTSW 11 67,817,247 (GRCm39) missense probably damaging 0.99
R4922:Cfap52 UTSW 11 67,822,548 (GRCm39) critical splice donor site probably null
R5624:Cfap52 UTSW 11 67,818,184 (GRCm39) missense possibly damaging 0.92
R5762:Cfap52 UTSW 11 67,844,947 (GRCm39) missense possibly damaging 0.71
R5970:Cfap52 UTSW 11 67,821,570 (GRCm39) missense probably damaging 1.00
R6037:Cfap52 UTSW 11 67,837,126 (GRCm39) missense probably benign 0.00
R6037:Cfap52 UTSW 11 67,837,126 (GRCm39) missense probably benign 0.00
R6260:Cfap52 UTSW 11 67,829,780 (GRCm39) missense possibly damaging 0.85
R7401:Cfap52 UTSW 11 67,840,459 (GRCm39) missense probably benign 0.02
R7580:Cfap52 UTSW 11 67,837,146 (GRCm39) missense probably damaging 1.00
R7831:Cfap52 UTSW 11 67,826,782 (GRCm39) missense possibly damaging 0.89
R7966:Cfap52 UTSW 11 67,844,571 (GRCm39) splice site probably null
R8303:Cfap52 UTSW 11 67,830,621 (GRCm39) missense probably benign 0.00
R8998:Cfap52 UTSW 11 67,818,137 (GRCm39) missense probably damaging 1.00
R8999:Cfap52 UTSW 11 67,818,137 (GRCm39) missense probably damaging 1.00
R9074:Cfap52 UTSW 11 67,822,656 (GRCm39) missense probably benign 0.32
R9169:Cfap52 UTSW 11 67,844,860 (GRCm39) missense possibly damaging 0.67
R9394:Cfap52 UTSW 11 67,815,921 (GRCm39) makesense probably null
R9645:Cfap52 UTSW 11 67,837,179 (GRCm39) missense possibly damaging 0.68
R9683:Cfap52 UTSW 11 67,822,639 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCTCATTTCTGCCCCAAAGAGC -3'
(R):5'- ACAGCACTGACTCCTGTCTAACTCC -3'

Sequencing Primer
(F):5'- CCATGTAAAGTGGGGCTTTTCTC -3'
(R):5'- AACTCCTTCTCCTACGTTCCAG -3'
Posted On 2013-05-23