Mutagenetix > Incidental Mutation

Incidental Mutation 'R4916:Adcy10'

380022

Institutional Source

Beutler Lab

Gene Symbol

Adcy10

Ensembl Gene

ENSMUSG00000026567

Gene Name

adenylate cyclase 10

Synonyms

sAC, Sacy, soluble adenylyl cyclase

MMRRC Submission

042518-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.376) question?

Stock #

R4916 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

165485183-165576774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 165518246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 288 (E288G)

Ref Sequence

ENSEMBL: ENSMUSP00000137959 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]

AlphaFold

Q8C0T9

Predicted Effect

probably damaging
Transcript: ENSMUST00000027852
AA Change: E288G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: E288G

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	442	2.3e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	6e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000111439
AA Change: E288G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: E288G

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000111440
AA Change: E288G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: E288G

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000148550
AA Change: E288G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: E288G

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	420	4.3e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155216

SMART Domains

Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

Domain	Start	End	E-Value	Type
PDB:4OZ3\|A	1	98	2e-51	PDB
Blast:CYCc	7	98	2e-61	BLAST
SCOP:d1azsb_	43	98	9e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194554

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195194

Meta Mutation Damage Score

0.3410

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930595D18Rik	G	A	12: 111,174,935	Q19*	probably null	Het
5430419D17Rik	T	A	7: 131,174,477		probably null	Het
6030468B19Rik	T	A	11: 117,806,266	C230*	probably null	Het
A730017C20Rik	A	T	18: 59,072,205	I22F	probably damaging	Het
Adnp	T	A	2: 168,187,617	T51S	possibly damaging	Het
Agap3	C	A	5: 24,478,013	A464D	probably damaging	Het
Ago4	A	C	4: 126,506,842	C693G	probably damaging	Het
Ahi1	A	G	10: 20,984,404	R675G	probably damaging	Het
Amigo1	T	A	3: 108,187,665	L160Q	probably damaging	Het
Ankrd35	T	C	3: 96,684,122	S575P	probably benign	Het
Ano3	T	A	2: 110,771,020	T298S	possibly damaging	Het
Ap2b1	T	G	11: 83,390,706	F813V	probably damaging	Het
Aplnr	T	G	2: 85,136,917	F95L	probably damaging	Het
Apobec2	T	C	17: 48,423,125	E171G	probably benign	Het
Ascc1	A	G	10: 60,004,862	N15S	probably benign	Het
AY358078	T	A	14: 51,802,651	Y73N	unknown	Het
B3gnt8	C	A	7: 25,628,883	P246Q	probably damaging	Het
C2cd2l	T	C	9: 44,316,560	Q250R	probably damaging	Het
Camk2d	T	C	3: 126,783,975	Y180H	probably damaging	Het
Ccdc129	C	T	6: 55,978,190	P928S	possibly damaging	Het
Ccdc170	A	G	10: 4,518,971	E167G	probably damaging	Het
Cdyl2	A	G	8: 116,579,187	M445T	probably damaging	Het
Clca1	T	C	3: 145,015,844	D322G	probably benign	Het
Cnot10	C	T	9: 114,629,134	M101I	possibly damaging	Het
Cntrl	C	T	2: 35,165,682	T1196M	probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dcaf6	T	C	1: 165,420,205	D153G	probably damaging	Het
Dennd2c	G	A	3: 103,131,824	G96E	probably benign	Het
Dhrs9	T	C	2: 69,401,408	F304S	probably damaging	Het
Dmxl1	T	C	18: 49,877,697	S974P	probably damaging	Het
Dnah6	T	C	6: 73,192,676		probably benign	Het
Dnah7c	T	C	1: 46,595,008	L1049P	probably damaging	Het
Dnajc2	T	C	5: 21,757,340	K621E	probably damaging	Het
Ehbp1	T	C	11: 22,146,592	D299G	probably benign	Het
Erap1	A	G	13: 74,646,528	E102G	probably benign	Het
Fasn	T	G	11: 120,816,646	N799T	probably benign	Het
Fbxl20	T	C	11: 98,128,360	D22G	probably damaging	Het
Fgfr1	T	C	8: 25,563,526		probably null	Het
Frzb	A	T	2: 80,446,527	I105N	probably damaging	Het
Gabrb1	T	A	5: 71,869,421	F55Y	probably damaging	Het
Gatd1	G	T	7: 141,409,097	C216*	probably null	Het
Gnl2	A	C	4: 125,043,692	N255T	probably damaging	Het
Golgb1	A	T	16: 36,916,118	Q1909L	probably benign	Het
Gpnmb	T	C	6: 49,051,970	L474P	probably damaging	Het
H60b	T	C	10: 22,287,216	V230A	possibly damaging	Het
Hmcn2	T	A	2: 31,360,980	V818D	probably damaging	Het
Jade2	G	T	11: 51,817,082	T768K	probably benign	Het
Kif28	T	C	1: 179,702,520	H692R	probably benign	Het
Kmt2b	T	C	7: 30,578,517	N1634S	probably damaging	Het
Knop1	A	G	7: 118,846,076	W222R	probably damaging	Het
Lrmp	C	A	6: 145,165,301	S277R	probably damaging	Het
Map1b	T	C	13: 99,433,300	D971G	unknown	Het
Mapk7	G	T	11: 61,493,649	T77K	probably damaging	Het
Mcm6	A	G	1: 128,348,977	L292P	probably damaging	Het
Megf8	T	C	7: 25,339,664	L900P	probably benign	Het
Meis1	G	A	11: 18,881,776	H421Y	possibly damaging	Het
Mllt1	T	C	17: 56,899,813	T344A	probably benign	Het
Mta1	T	A	12: 113,136,540	S657T	probably benign	Het
Mtus1	C	A	8: 41,000,801	K998N	probably damaging	Het
Ncdn	G	A	4: 126,749,938	L364F	possibly damaging	Het
Ndufb7	T	C	8: 83,570,905	L63P	probably damaging	Het
Nfix	T	C	8: 84,771,829	I172V	probably benign	Het
Nos1	T	C	5: 117,947,570		probably null	Het
Nrp1	C	A	8: 128,502,804	S921*	probably null	Het
Olfr1459	T	A	19: 13,145,991	I223L	possibly damaging	Het
Olfr401	A	T	11: 74,121,879	I197F	probably benign	Het
Oma1	T	C	4: 103,319,530		probably null	Het
Pcp2	T	A	8: 3,625,534		probably benign	Het
Pdk4	T	A	6: 5,489,157	H250L	possibly damaging	Het
Phldb3	A	G	7: 24,624,291	H449R	probably benign	Het
Pip4k2c	T	C	10: 127,199,327	T391A	possibly damaging	Het
Polrmt	A	G	10: 79,746,551	M1T	probably null	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prkcg	T	G	7: 3,330,265	Y624*	probably null	Het
Psmg2	A	G	18: 67,648,856	E164G	probably damaging	Het
Rb1	A	T	14: 73,216,691	L589H	probably damaging	Het
Rcvrn	A	T	11: 67,695,765	I117F	probably damaging	Het
Rere	T	A	4: 150,619,144	W1528R	probably damaging	Het
Robo2	A	G	16: 73,898,915	S1447P	possibly damaging	Het
Scfd2	C	A	5: 74,462,658	G405W	probably damaging	Het
Scin	T	A	12: 40,069,374	I552F	possibly damaging	Het
Serpina3k	G	A	12: 104,343,010	V238M	probably damaging	Het
Slc1a6	G	A	10: 78,796,251	V304M	probably damaging	Het
Slc20a2	C	T	8: 22,561,004	S351L	probably damaging	Het
Slc31a2	T	C	4: 62,297,088	V124A	probably damaging	Het
Slc38a3	T	C	9: 107,656,227	N244S	probably benign	Het
Slc4a1	A	G	11: 102,352,453	V784A	probably damaging	Het
Slc6a5	T	C	7: 49,948,256	F623L	probably benign	Het
Slf2	T	G	19: 44,971,661	D1022E	probably damaging	Het
Slfn8	G	A	11: 83,016,878	H280Y	probably damaging	Het
Smpdl3a	A	T	10: 57,801,031	D45V	probably damaging	Het
Ssh3	T	C	19: 4,265,142	E342G	probably damaging	Het
Tacr1	A	T	6: 82,554,941	I273F	probably benign	Het
Tfg	T	A	16: 56,694,396		probably null	Het
Tmem179	A	G	12: 112,501,834	L71P	probably damaging	Het
Tmem63a	T	A	1: 180,966,521	I541N	probably benign	Het
Traj20	G	A	14: 54,199,467		probably benign	Het
Trappc13	A	T	13: 104,154,294		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tulp1	A	G	17: 28,359,135	L310P	probably damaging	Het
Ube2cbp	A	G	9: 86,422,872	Y306H	probably damaging	Het
Urb1	A	T	16: 90,783,328	V649E	probably damaging	Het
Vps13d	A	G	4: 144,983,393	L4211P	probably damaging	Het
Vwa5b1	T	A	4: 138,594,262	I407F	possibly damaging	Het
Vwce	G	T	19: 10,646,879	C378F	probably damaging	Het
Zfp791	T	A	8: 85,110,951	I95L	probably benign	Het

Other mutations in Adcy10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Adcy10	APN	1	165551914	missense	probably benign	0.45
IGL00731:Adcy10	APN	1	165572614	missense	probably benign
IGL01099:Adcy10	APN	1	165539842	missense	probably benign	0.21
IGL01464:Adcy10	APN	1	165546587	missense	probably damaging	1.00
IGL01729:Adcy10	APN	1	165513168	critical splice donor site	probably null
IGL02002:Adcy10	APN	1	165521843	missense	probably damaging	1.00
IGL02094:Adcy10	APN	1	165570620	missense	probably damaging	1.00
IGL02132:Adcy10	APN	1	165572543	missense	probably damaging	0.96
IGL02276:Adcy10	APN	1	165559128	missense	probably damaging	0.96
IGL02408:Adcy10	APN	1	165538380	missense	probably damaging	1.00
IGL02410:Adcy10	APN	1	165510408	missense	probably damaging	1.00
IGL02445:Adcy10	APN	1	165570744	missense	possibly damaging	0.85
IGL02470:Adcy10	APN	1	165567726	missense	probably damaging	1.00
IGL02551:Adcy10	APN	1	165543233	missense	probably damaging	1.00
IGL02606:Adcy10	APN	1	165519518	missense	possibly damaging	0.88
IGL02609:Adcy10	APN	1	165538475	nonsense	probably null
Bugged	UTSW	1	165564237	missense	probably damaging	0.99
debye	UTSW	1	165551361	critical splice donor site	probably null
malaysian	UTSW	1	165513127	missense	probably benign	0.38
singaporean	UTSW	1	165518312	missense	probably damaging	0.98
PIT4514001:Adcy10	UTSW	1	165556791	missense	probably benign	0.28
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0276:Adcy10	UTSW	1	165572591	missense	possibly damaging	0.88
R0324:Adcy10	UTSW	1	165564249	missense	probably benign	0.00
R0433:Adcy10	UTSW	1	165552022	missense	probably damaging	1.00
R0454:Adcy10	UTSW	1	165570728	missense	probably damaging	1.00
R0501:Adcy10	UTSW	1	165510390	missense	probably damaging	1.00
R0513:Adcy10	UTSW	1	165519519	missense	probably benign	0.04
R0533:Adcy10	UTSW	1	165564023	missense	probably benign	0.05
R0550:Adcy10	UTSW	1	165565315	missense	probably benign	0.00
R0554:Adcy10	UTSW	1	165513130	missense	probably benign
R0597:Adcy10	UTSW	1	165525062	critical splice donor site	probably null
R0629:Adcy10	UTSW	1	165543105	missense	probably damaging	1.00
R1421:Adcy10	UTSW	1	165563947	missense	probably damaging	0.98
R1454:Adcy10	UTSW	1	165515380	missense	possibly damaging	0.66
R1524:Adcy10	UTSW	1	165518403	missense	probably damaging	1.00
R1534:Adcy10	UTSW	1	165518312	missense	probably damaging	0.98
R1594:Adcy10	UTSW	1	165525033	missense	probably benign	0.02
R1690:Adcy10	UTSW	1	165519925	missense	probably damaging	1.00
R1842:Adcy10	UTSW	1	165503243	missense	probably damaging	1.00
R1859:Adcy10	UTSW	1	165521961	missense	probably damaging	1.00
R1885:Adcy10	UTSW	1	165570808	missense	probably benign	0.02
R1929:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2005:Adcy10	UTSW	1	165525022	missense	probably benign	0.02
R2211:Adcy10	UTSW	1	165518212	missense	probably damaging	1.00
R2225:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2227:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2272:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2421:Adcy10	UTSW	1	165558597	missense	probably damaging	0.97
R3614:Adcy10	UTSW	1	165575727	missense	probably benign	0.38
R4538:Adcy10	UTSW	1	165513127	missense	probably benign	0.38
R4644:Adcy10	UTSW	1	165551361	critical splice donor site	probably null
R4649:Adcy10	UTSW	1	165504049	missense	probably damaging	1.00
R4832:Adcy10	UTSW	1	165506644	missense	probably damaging	1.00
R4853:Adcy10	UTSW	1	165548213	missense	probably benign
R4951:Adcy10	UTSW	1	165563963	missense	probably damaging	1.00
R4972:Adcy10	UTSW	1	165556862	missense	probably damaging	1.00
R5116:Adcy10	UTSW	1	165519500	missense	probably damaging	1.00
R5377:Adcy10	UTSW	1	165519895	missense	probably damaging	1.00
R5442:Adcy10	UTSW	1	165513140	missense	probably benign	0.43
R5692:Adcy10	UTSW	1	165515306	missense	probably benign	0.36
R5949:Adcy10	UTSW	1	165539817	missense	possibly damaging	0.79
R5998:Adcy10	UTSW	1	165541649	missense	probably benign	0.19
R6238:Adcy10	UTSW	1	165575728	nonsense	probably null
R6455:Adcy10	UTSW	1	165518374	missense	probably damaging	1.00
R6920:Adcy10	UTSW	1	165575658	missense	probably damaging	1.00
R6935:Adcy10	UTSW	1	165506635	missense	probably benign	0.21
R6957:Adcy10	UTSW	1	165564285	missense	probably damaging	1.00
R6970:Adcy10	UTSW	1	165556916	missense	probably benign	0.02
R7027:Adcy10	UTSW	1	165518246	missense	probably damaging	1.00
R7049:Adcy10	UTSW	1	165539874	missense	probably damaging	1.00
R7062:Adcy10	UTSW	1	165538522	missense	probably benign	0.27
R7130:Adcy10	UTSW	1	165504047	missense	probably damaging	1.00
R7144:Adcy10	UTSW	1	165510370	missense	probably benign	0.01
R7182:Adcy10	UTSW	1	165543470	splice site	probably null
R7228:Adcy10	UTSW	1	165510272	missense	probably damaging	1.00
R7384:Adcy10	UTSW	1	165576608	missense	unknown
R7561:Adcy10	UTSW	1	165559172	missense	possibly damaging	0.94
R7603:Adcy10	UTSW	1	165564237	missense	probably damaging	0.99
R7693:Adcy10	UTSW	1	165570771	missense	probably benign	0.01
R7812:Adcy10	UTSW	1	165515369	missense	probably damaging	1.00
R7905:Adcy10	UTSW	1	165513168	critical splice donor site	probably null
R8040:Adcy10	UTSW	1	165552024	missense	probably damaging	1.00
R8242:Adcy10	UTSW	1	165546549	missense	possibly damaging	0.82
R8278:Adcy10	UTSW	1	165503288	missense	probably damaging	1.00
R8282:Adcy10	UTSW	1	165510337	missense	probably benign	0.34
R8812:Adcy10	UTSW	1	165551298	missense	probably damaging	0.98
R9039:Adcy10	UTSW	1	165518345	missense	probably damaging	1.00
R9178:Adcy10	UTSW	1	165575649	missense	possibly damaging	0.79
R9244:Adcy10	UTSW	1	165543110	missense	probably benign	0.00
R9712:Adcy10	UTSW	1	165513112	missense	probably damaging	1.00
RF018:Adcy10	UTSW	1	165552109	missense	probably damaging	1.00
Z1177:Adcy10	UTSW	1	165510276	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGTGACTTGTGCCTCACAC -3'
(R):5'- GTCCTTGGACTCAGTGCTAAC -3'

Sequencing Primer
(F):5'- CACACTGAGATAGCTTCAGTTGCTG -3'
(R):5'- GTGCTAACCTTACACTACGGG -3'

Posted On

2016-04-15